Labshake search
Citations for Addgene :
3051 - 3100 of 10000+ citations for Human GSDMC shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... Lentiviral packaging plasmids pMD2.G (a gift from Didier Trono, Addgene plasmid #12259; http://n2t.net/addgene:12259; RRID:Addgene_12259), psPAX2 (a gift from Didier Trono ...
-
bioRxiv - Molecular Biology 2019Quote: ... p5343 was cloned into the vector pUC57 resulting in plasmid p5343_UC57 (plasmid and sequence available via Addgene 126645).
-
bioRxiv - Molecular Biology 2019Quote: ... Streptomyces pyogenes (sp) guide RNA sequences (Table 2) were cloned into the LentiGuide-Puro plasmid (plasmid #52963, Addgene). lentiGuide-Puro was a gift from Feng Zhang (Addgene plasmid # 52963 ...
-
bioRxiv - Synthetic Biology 2019Quote: All single guide RNAs were cloned in BbsI-linearized pCFD3-dU6:3 gRNA plasmid (a gift from Simon Bullock; Addgene plasmid # 49410; http://n2t.net/addgene:49410; RRID:Addgene_49410) (Port et al ...
-
bioRxiv - Synthetic Biology 2019Quote: ... Array1_Cas9_PCR2_R and Array1_Cas9_PCR3_R and cloned in pCFD5 plasmid (a gift from Simon Bullock; Addgene plasmid # 73914; http://n2t.net/addgene:73914; RRID:Addgene_73914) (Port and Bullock 2016) ...
-
bioRxiv - Synthetic Biology 2019Quote: ... The arrays were cloned in pCFD4-U6:1_U6:3 tandem gRNAs plasmid (a gift from Simon Bullock; Addgene plasmid # 49411; http://n2t.net/addgene:49411; RRID:Addgene_49411). The plasmids pCFD3 ...
-
bioRxiv - Biochemistry 2020Quote: ... was amplified from PCC 7002 while APEX2 was amplified from a plasmid gifted to us by Alice Ting (Addgene plasmid # 72558; http://n2t.net/addgene:72558; RRID:Addgene_72558). Plasmids were assembled using Gibson Assembly (Gibson et al. ...
-
bioRxiv - Synthetic Biology 2020Quote: Lentivirus production was performed using HEK-293FT cells and second-generation helper plasmids MD2.G (Addgene plasmid #12259) and psPax2 (Addgene plasmid #12260) ...
-
bioRxiv - Microbiology 2019Quote: ... 1.5 million fibroblast cells were transfected with the homologous recombination donor plasmid and an helper plasmid (Addgene #64221) (21) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and was inserted into BpiI sites of a pSpCas9(BB)-2A-Puro (PX459) V2.0 plasmid (Addgene, Plasmid #62988). All sgRNAs used in the present study were designed using CRISPR DESIGN (http://crispr.mit.edu/ ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Plasmids pMD2.G and pCMV-dR8.2 dvpr were a gift from Didier Trono (Addgene plasmid # 12259 and 8455).
-
bioRxiv - Synthetic Biology 2020Quote: ... The Sleeping Beauty transposase plasmid pCMV(CAT) T7-SB100 was a gift from Zsuzsanna Izsvak (Addgene plasmid # 34879). The Sleeping Beauty plasmids pSBBi-RP ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... the same primary gRNA sequence used for germline CRISPR-Cas9 experiments described above was adapted and cloned into BbsI-digested pCFD6 plasmid [a gift from Simon Bullock (Addgene plasmid # 73915; http://n2t.net/addgene:73915; RRID:Addgene_73915]116 using a primer annealing strategy with primers #681_DILP8-GuideRNA_1_F-ALT TGCAGCACTGGTTTAGACAGCAGT and #201_DILP8-GuideRNA_1_R ...
-
bioRxiv - Neuroscience 2020Quote: ... DNA fragment of Cre was prepared by PCR and transferred to retroviral plasmid backbone (a gift from Fred Gage (Addgene plasmid # 49054; http://n2t.net/addgene:49054; RRID:Addgene_49054)) by restriction digestion and ligation to obtain a pRetro-CAG-Cre-WPRE ...
-
bioRxiv - Neuroscience 2020Quote: ... lentivirus-compatible plasmids were engineered to express dCas9 fused to VPR (Addgene plasmid # 114196 (Savell et al., 2019). A Cre-dependent DIO version of this dCas9-VPR construct was generated by insertion of LoxP and Lox2272 sequences flanking the dCas9-VPR cassette ...
-
bioRxiv - Immunology 2021Quote: ... an envelope deficient HIV-1 dual reporter construct that was cloned by recombination of the pNL.luc.R-E-plasmid (NIH AIDS Reagent Program) and the fully infectious pNL4-3 mCherry luciferase plasmid (Addgene) [24 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The ompT protease gene was deleted using standard recombineering methods by selection for an apramycin selectable marker obtained from the pMDIA plasmid.69 pMDIAI was a gift from Sheng Yang (Addgene plasmid # 51655; http://n2t.net/addgene:51655; RRID:Addgene_51655). Primers and DNA sequences are given in Supplemental Materials Section 3 ...
-
bioRxiv - Neuroscience 2021Quote: ... Lentiviral constructs were all subcloned into the FUGW transfer plasmid (FUGW was a gift from David Baltimore (Addgene plasmid # 14883; http://n2t.net/addgene:14883; RRID:Addgene_14883)) (Lois ...
-
bioRxiv - Biochemistry 2021Quote: ... Electrocompetent BW25113 cells were co-transformed with the pORTMAGE-4 plasmid (Addgene plasmid #72679, courtesy of Csaba Pál) and the pBAD-yTrm5 plasmid ...
-
bioRxiv - Neuroscience 2021Quote: ... we co-transfected neurofilament medium chain (NFM) cDNA-containing plasmid pmNFM (a gift from Anthony Brown, Addgene plasmid #83126; http://n2t.net/addgene:83126;RRID:Addgene_83126)63.
-
bioRxiv - Neuroscience 2021Quote: ... http://n2t.net/addgene:83127;RRID:Addgene_83127)63 and initially cloned in an mEGFP-N1 plasmid (a gift from Michael Davidson, Addgene plasmid #54767; http://n2t.net/addgene:54767;RRID:Addgene_54767) using HindIII (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... we used a pORANGE Tubb3-GFP KI plasmid (a gift from Harold MacGillavry, Addgene plasmid #131497; http://n2t.net/addgene:131497;RRID:Addgene_131497)30 ...
-
bioRxiv - Cancer Biology 2020Quote: HEK293T cells were transfected with packaging plasmid psPAX2 and envelope plasmid pMD2.G (both gifts from Didier Trono, Addgene plasmid # 12260; http://n2t.net/addgene:12260; RRID:Addgene_12260 and Addgene plasmid # 12259 ...
-
bioRxiv - Cancer Biology 2020Quote: ... plasmids were packaged into lentivirus through transfection of the plasmids with a packaging plasmid (psPAX2 was a gift from Didier Trono (Addgene plasmid # 12260; http://n2t.net/addgene:12260; RRID:Addgene_12260)) and an envelope plasmid (CMV-VSV-G was a gift from Bob Weinberg (Addgene plasmid # 8454 ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2 μg of total plasmid DNA/well were used in appropriate combinations of the plasmids: pLVX-puro (Addgene), pLVX-puro-TRIM67-Flag ...
-
bioRxiv - Cell Biology 2020Quote: ... pJW1259 was used as Cas9 plasmid and was a gift from Jordan Ward (Addgene plasmid # 61251; http://n2t.net/addgene:61251; RRID:Addgene_61251) (Ward ...
-
bioRxiv - Genomics 2021Quote: ... Plasmids constructed for this study can be found in Supplementary Table S5 (plasmids available at Addgene.org are indicated).
-
bioRxiv - Microbiology 2020Quote: ... The ace2 gene was amplified from a plasmid gifted by Hyeryun Choe 14 (Addgene plasmid # 1786; http://n2t.net/addgene:1786; RRID:Addgene_1786) using CoV-39 and CoV-40 primers ...
-
bioRxiv - Microbiology 2020Quote: ... CRISPR/Cas-9 vectors were derived from the plasmid lentiCRISPRv2 (a gift from Feng Zhang; Addgene plasmid # 52961; http://n2t.net/addgene:52961; RRID:Addgene_52961) [32] ...
-
bioRxiv - Microbiology 2019Quote: ... The plasmid pPH-Akt-GFP encoding PH-Akt - GFP was a gift from Tamas Balla (Addgene plasmid # 51465). The plasmid encoding GFP tagged with a glycosylphosphatidylinositol (GPI ...
-
bioRxiv - Immunology 2021Quote: ... gRNAs were purchased from Integrated DNA Technologies (Coralville, IA) and cloned into the pX335 plasmid (Addgene, plasmid #42335) encoding genetically modified Cas9 endonuclease which generates nicks ...
-
bioRxiv - Immunology 2021Quote: ... The pLEX307-ACE2-puro plasmid was a gift from Alejandro Chavez and Sho Iketani (Addgene plasmid # 158448; http://n2t.net/addgene: 158448; RRID:Addgene_158448).
-
bioRxiv - Immunology 2020Quote: Plasmid encoding untagged ACE2 was a gift from Hyeryun Choe (Addgene plasmid # 1786; http://n2t.net/addgene:1786;RRID:Addgene_786). Transfection of HEK293T cell lines stably expressing human IFITM1 ...
-
bioRxiv - Immunology 2020Quote: ... were transfected with pBABE-neo largeTcDNA plasmid (a gift from Bob Weinberg; Addgene plasmid # 1780; http://n2t.net/addgene:1780; RRID:Addgene_1780)5 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... PDGF-TMD-GFP plasmid (pFU-no toxin-PE) was a gift from Ines Ibanez-Tallon (Addgene plasmid # 24149) 29.
-
bioRxiv - Immunology 2021Quote: ... The plasmid was then co-injected into the pronucleus with a repair template plasmid (i.e. targeting vector, Addgene) containing an IRES-DTR-tdTomato fusion cassette ...
-
bioRxiv - Molecular Biology 2020Quote: ... The TRIPZ plasmid was transfected into 293T cells along with lentiviral packaging and envelope 2nd generation plasmids (Addgene packaging 11263 ...
-
bioRxiv - Immunology 2021Quote: ... Cells were co-transfected with either plasmid #166856 or #166857 and a plasmid encoding BirA ligase (Addgene #32408) at a 4:1 ratio (m/m) ...
-
bioRxiv - Microbiology 2022Quote: ... Lentiviral packaging was carried out using packaging plasmids pMDLg/pRRE (Addgene plasmid # 12251 ; http://n2t.net/addgene:12251 ; RRID:Addgene_12251), Addgene plasmid # 12253 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The 4272 bp ORF of Cas9 was then amplified from the pHsp70 Cas9 plasmid (Addgene plasmid #46294 (32)) using primers BR-34 and BR-35 and inserted into pBluescript downstream of the nanos promoter fragment using a NcoI and SalI digest for the PCR product and a PciI/SalI digest for the plasmid vector ...
-
bioRxiv - Cancer Biology 2022Quote: ... with 6μg of the plasmid of interest and 6μg of the packaging plasmids pCMV-VSV-G (Addgene, 8454) and pCMVdR8.2 dvpr (Addgene ...
-
bioRxiv - Cell Biology 2022Quote: ... The PA-mCherry sequence was cloned into pShuttle-CMV plasmid (gift from Dr. Bert Vogelstein – Addgene plasmid # 16403; http://n2t.net/addgene:16403; RRID:Addgene_16403). An adenovirus construct was generated using the pAdeasy system[55].
-
bioRxiv - Cell Biology 2022Quote: We replaced the ORF of the GFP marker in the pSpCas9(BB)2A-GFP plasmid (Addgene plasmid #48138) by the ORF of iRFP670 ...
-
bioRxiv - Microbiology 2022Quote: ... The plasmid pPH-Akt-GFP encoding PH-Akt -GFP was a gift from Tamas Balla (Addgene plasmid # 51465). The plasmids encoding wild type Rac1 tagged with GFP (Rac1-wt-GFP ...
-
bioRxiv - Neuroscience 2022Quote: ... the Adamts2 or TGFβR2 coding sequence was amplified by PCR using mouse Adamts2 and TGFβR2 ORF plasmids (pCMV-Adamts2, Harvard plasmid clones; pCMV-TGFβR2, Addgene) as templates ...
-
bioRxiv - Microbiology 2023Quote: ... along with a plasmid expressing Cas9 fused with GFP (pCas9 GFP, gift from Kiran Musunuru: Addgene plasmid #44719). The following target sequences were used ...
-
bioRxiv - Neuroscience 2022Quote: ... Lentivirus was created from this plasmid by co-transfecting HEK293T cells with this plasmid alongside psPAX2 (Addgene #12260) and MD2.G (Addgene #12259) ...
-
bioRxiv - Neuroscience 2022Quote: ... HEK293T WT cells were transfected using Lipofectamine3000 with pLenti plasmids and lentiviral packaging plasmids (Gag-pol (Addgene #14887), VSV-G (Addgene #8454) ...
-
bioRxiv - Neuroscience 2022Quote: ... lentiviral constructs were subcloned into the FUGW transfer plasmid (FUGW was a gift from David Baltimore (Addgene plasmid # 14883 ; http://n2t.net/addgene:14883 ; RRID:Addgene_14883)) (Lois ...
-
bioRxiv - Neuroscience 2022Quote: ... using the established and published plasmids pLenti-FUW-M2rtTA (FUW-M2rtTA deposited by Rudolf Jaenisch, Addgene plasmid #20342; http://n2t.net/addgene:20342; RRID:Addgene_20342,59), pLenti-TetO-hNGN2-eGFP-puro (pLV- TetO-hNGN2-eGFP-Puro deposited by Kristen Brennand ...