Labshake search
Citations for Addgene :
3151 - 3200 of 4199 citations for 6H Dibenzo a g quinolizinium 5 8 13 13a tetrahydro 2 9 dihydroxy 3 10 dimethoxy 7 methyl 7S 13aS since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... pAAV.Syn.Flex.GCaMP6f.WPRE.SV40 virus (500 nL, titer ≥ 1X1013 vg/mL, working dilution 1:5, Addgene, #100833-AAV9 ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 μg pMDLg/RRE and 2.5 μg pRSV-REV (Addgene #14888, #12251, #12253) using calcium phosphate ...
-
bioRxiv - Cell Biology 2022Quote: ... The hCRISPRi-v2 compact library (5 sgRNAs per gene, Addgene pooled library #83969) was transduced in duplicate into 330 million K562-CRISPRi-Tet-ON-((MICU1)-GFP1-10)-(tet-RFP-P2A-OMP25-GFP11 ...
-
bioRxiv - Molecular Biology 2023Quote: ... to remove the neomycin selection cassette or both 5 μg pFlpO (Addgene #13792) and 5 µg of pCrePac(Taniguchi ...
-
bioRxiv - Neuroscience 2023Quote: The following viruses were used: AAV2/5-ef1alpha-FLEX-taCasp3-TEVp (Addgene, 45580) and AAV2/1-CAG-FLEX-EGFP-WPRE (Addgene ...
-
bioRxiv - Biochemistry 2023Quote: Guide RNA targeting PARP1 (5’- CCACCTCAACGTCAGGGTGC) was cloned into LentiCRISPRv2 vector (Addgene, 52961). Lentivirus carrying CRISPR/Cas9-PARP1 guide was transduced to HCT116 in the presence of 8 μg/ml polybrene ...
-
bioRxiv - Biochemistry 2023Quote: Guide RNA targeting ATP6V1B2 (5’- AAACTTACCATCATTAGGCA) was cloned into pX330 vector (Addgene, #42230). HCT116 cells were transfected with the guide RNA and single-stranded oligo 5’- tacatgtatacagatttagccacgatatatgaacgcgctgggcgagtggaagggagaaacggctcgattactcaaatccctattctGacAatgcctaatA atggtaagttttggtatttggattataacacacctaatcattttaaagagagagaagacccatctaccttttcgagttgaagttattttgagaacacatc using TransIT-LT (Mirus) ...
-
bioRxiv - Biochemistry 2023Quote: Guide RNA targeting PARP1 (5’- AAACATGTAGCCTGTCTGGA) was cloned into pX330 vector (Addgene, #42230). HCT116 cells were transfected with the guide RNA and single-stranded oligo 5’- tcagtgaacagctgctcctaatttcccatcagaagattctcagctctcccttttccgaccttccagacaggctacatgtttggtaaagggatcta tttcactgatatggtctccaagagtgccaactactgccatacgtctcagggagacccaataggcttaatcctgttgggagaagttgcccttggaaacatgtg agt for A898T mutation and 5’- tggcactcagtgaacagctgctcctaatttcccatcagaagattctcagctctcccttttccgaccttccag acaggctacatgtttggtaaaggaatctgtttcgctgacatggtctccaagagtgccaactactgccatacgtctcagggagacccaataggcttaatc ctgttgggagaagttgcccttggaaacat for Y896C mutation using TransIT-LT (Mirus) ...
-
bioRxiv - Neuroscience 2023Quote: ... mixed at a 5:1 ratio with pCMV(CAT)T7-SB100 (Addgene #34879), and co-transfected to HEK293T cells using TransIT-293 (Mirus) ...
-
bioRxiv - Neuroscience 2023Quote: ... mice were injected with 0.5 µl of AAV2/5-CaMKIIα-GCaMP6f (Addgene, #100834) into the vH (AP -3.28 mm ...
-
bioRxiv - Cancer Biology 2024Quote: ... 500 ng purified oligo were mixed with 5 μg lentiCRISPR v2 (Addgene #52961) backbone ...
-
Structures of native SV2A reveal the binding mode for tetanus neurotoxin and anti-epileptic racetamsbioRxiv - Biochemistry 2024Quote: ... Nb1-5 were PCR amplified and subcloned into the vector pBXNPHM365 (Addgene #11099) and fused with a C-terminal (TSII-tagged ...
-
bioRxiv - Developmental Biology 2024Quote: ... worms were grown on bacteria expressing double stranded RNA for him-8/klp-16 using the pLT 651 plasmid (Addgene plasmid # 59998, Timmons et al., 2014).
-
bioRxiv - Cell Biology 2021Quote: ... pRS315-NOP1pr-GFP11-mCherry-PUS1) and GFP1-10 (pSJ2039, pRS316-NOP1pr-GFP1-10-SCS2TM) were a gift from Sue Jaspersen (Addgene plasmids # 86413 and # 86418) 48 ...
-
bioRxiv - Neuroscience 2020Quote: ... excitatory Gq DREADD (AAV8-hSyn-hM3Gq-mCherry; Addgene; n = 10); and control construct (AAV5-hSyn-EYFP ...
-
bioRxiv - Biochemistry 2020Quote: ... Fyn was amplified from mEos2-FYN2-N-10 (Addgene 57380) and assembled into pBlueScript with either a mec-4 or osm-10 promoter and the unc-54 3’UTR using the NEBuilder HiFi DNA Assembly kit ...
-
bioRxiv - Molecular Biology 2024Quote: ... mCherry-LaminB1-10 was a gift from Michael Davidson (Addgene plasmid # 55069 ...
-
bioRxiv - Molecular Biology 2024Quote: ... with 10 μg of mito-V5-APEX (Addgene plasmid #72480) plasmid each ...
-
bioRxiv - Neuroscience 2023Quote: ... 200nL of AAV9-CaMKII-Cre (10^12 gcp/mL Addgene) was injected at a depth of 300µm in each craniotomies ...
-
bioRxiv - Bioengineering 2023Quote: ... 10 µg of psPAX2 (a gift from Didier Trono; Addgene plasmid # 12260 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... EGFP-Profilin-10 was a gift from Michael Davidson (Addgene plasmid # 56438 ...
-
bioRxiv - Immunology 2023Quote: ... 10 ug pRSV-Rev (kind gift from Didier Trono (Addgene plasmid #12253 ...
-
bioRxiv - Neuroscience 2023Quote: ... and AAV9-CaMKIIa-EGFP (titer: 1×10¹³ vg/mL, Addgene) for chemogenetic silencing and viral control ...
-
bioRxiv - Neuroscience 2023Quote: ... and pAAV.Syn.GCaMP6f.WPRE.SV40 (AAV1, titer order of magnitude 10-12 Addgene) was injected 200 μm below the dura at 4 different sites (25 nL each ...
-
bioRxiv - Molecular Biology 2024Quote: ... along with a pLenti6.2 expression plasmid (10 μg, Addgene #87071) carrying ARH3WT-Flag or ARH3H182RFlag using the calcium phosphate-mediated ProFection Mammalian Transfection System (Promega #E1200 ...
-
bioRxiv - Neuroscience 2024Quote: ... 10 µg of the lentiviral expression plasmids pUltra (Addgene #24129), pUltra-chili (Addgene #48687) ...
-
bioRxiv - Cell Biology 2022Quote: ... The control virus with VSV-G as the tropism and expression of mCherry was generated by co-transfection of pLV-mCherry and pMD2.G vector (Addgene, Watertown, MA, USA) into the Phoenix cells ...
-
bioRxiv - Cancer Biology 2022Quote: ... was purchased from VectorBuilder (Chicago, IL, USA) and the packaging plasmid psPAX2 (#12260) and envelope plasmid pMD2.G (#12259) were obtained from Addgene (Watertown, MA, USA). The plasmid GFP-pLVTHM (#12247 ...
-
bioRxiv - Neuroscience 2021Quote: ... and SAD-B19 helper proteins (N, 52.11 mg, Addgene 59924; P, 30.15 mg, Addgene 59925; L, 23.70 mg, Addgene 59922; G, 20.26 mg, Addgene 59921). Cells were maintained with DMEM with GlutaMAX supplement ...
-
bioRxiv - Genomics 2019Quote: 293FT cells were transfected with 3rd generation system lentiviral plasmids (pMDLg/pRRE, pRSV-Rev and pMD2.G; Addgene #12251, 12253 and 12259, respectively) to generate viral particles using the PEIpro reagent (Polyplus-Transfection) ...
-
bioRxiv - Cell Biology 2020Quote: ... the Mouse GeCKOv2 CRISPR knockout pooled library plasmids were co-transfected with packaging plasmids pCMV-VSV-G and pCMV-dR8.2 dvpr (Gifts from Bob Weinberg, Addgene plasmid #8485 and #8455) into HEK293T cells ...
-
bioRxiv - Microbiology 2022Quote: Lentiviral particles were generated by co-transfection of the expression constructs and 2nd generation packaging plasmids (psPAX2, Addgene#12260 & pMD2.G, Addgene#12259), using jetPEI DNA transfection reagent (Polyplus transfection ...
-
bioRxiv - Molecular Biology 2024Quote: ... For lentivirus production pCMV-VSV-G (envelope plasmid) and pCMV dR8.2 dvpr (packaging plasmid) were gifts from Bob Weinberg (Addgene # 8454 and #8455, respectively)25 ...
-
bioRxiv - Neuroscience 2023Quote: ... HEK293T cells were transfected with targeting plasmid and 3rd generation packing plasmid (pMD2.G, pMDLg/pRRE; Addgene #12251, and pRSV-Rev; Addgene #12253) together using Lipofectamine 2000 ...
-
bioRxiv - Genetics 2024Quote: ... We next used the Gateway™ LR Clonase™ II Enzyme mix to recombine each of the four PCR products into the pBID-UASC-G backbone (Addgene Plasmid #35202), which contains a φC31 integrase compatible attB sequence and UAS binding sites for the GAL4 expression system (Wang et al ...
-
bioRxiv - Neuroscience 2022Quote: ... ACS-4500) using Lipofectamine 2000 in FBS free Optimem together with the virus packaging plasmids (psPAX2 and pMD2-G, Addgene # 12260 and # 12259) and the plasmid expressing either wild-type U4atac or an Empty Vector ...
-
bioRxiv - Cancer Biology 2023Quote: ... Packaging 293T cells were transfected with KEAP1 single guide RNA (sgRNA) and helper vectors (pMD2.G and psPAX2; Addgene plasmid # 12259 and 12260) using Lipofectamine 3000 reagent (Cat ...
-
bioRxiv - Genetics 2024Quote: ... Lentivirus was produced from sgRNA plasmids by co-transfecting Lenti-X 293T (Takarabio, 632180) cells with the sgRNA plasmid library and packaging plasmids-psPAX2 and pMD2.G (Addgene, 12260 and 12259) using Trans-IT-293 transfection reagent (Mirus ...
-
bioRxiv - Cell Biology 2020Quote: ... a fragment containing the 3×Flag-nls-cas9-nls coding sequence isolated from pBS-Hsp70-cas9 (Addgene, #46294) with same enzymes was inserted ...
-
bioRxiv - Genetics 2021Quote: ... sgRNAs (single gRNA) expressing plasmid was generated using the pCFD3-dU6:3 gRNA vector (Plasmid ID: #49410, Addgene) as described in (Port et al. ...
-
bioRxiv - Developmental Biology 2021Quote: ... The injection mix was prepared in MilliQ H2O and contained 60 ng/mL Peft-3::Cas9 (Addgene #46168), 45 ng/mL each sgRNA plasmid ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’-GGG GGG GGC GGA ATT CTC AGT CTA TCT TTT CTT TCT GGA CCA GTC TGG GAG C-3’ and pmScarlet-C1 (gift from Dorus Gadella; Addgene plasmid # 85042; http://n2t.net/addgene:85042; RRID:Addgene_85042) and GFP-TM(SAC1 ...
-
bioRxiv - Genetics 2019Quote: ... Cells were co-transfected with luciferase reporter plasmids (Figure 2A) or a positive control (pAP1-3, Addgene 71258) and a renilla normalisation control (pGL4.74 ...
-
bioRxiv - Neuroscience 2019Quote: A 60 nl viral mix containing a 3:1 ratio of AAV2retro-Cre (AAVrg-pmSyn1-EBFP-cre, Addgene) and AAV2-GFP (UNC viral core ...
-
bioRxiv - Cell Biology 2019Quote: ... pCIG3 (pCMV-IRES-GFP version 3) was a gift from Felicia Goodrum (Addgene plasmid # 78264; http://n2t.net/addgene:78264; RRID:Addgene_78264). The fibroblasts were incubated at 37°C with 5% CO2 and 5% O2 ...
-
bioRxiv - Cell Biology 2021Quote: ... (generated by making 3 point mutations, I102N, H158E, and Y189A in the Addgene mEos2 plasmid #20341 [http://n2t.net/addgene:20341; RRID:Addgene_20341] ...
-
bioRxiv - Cell Biology 2021Quote: ... (generated by making 3 point mutations, I102N, H158E, and Y189A in the Addgene mEos2 plasmid #20341 [http://n2t.net/addgene:20341; RRID:Addgene_20341] ...
-
bioRxiv - Cell Biology 2020Quote: ... pDD162 (Peft-3::Cas9 + Empty sgRNA) was a gift from Bob Goldstein (Addgene plasmid # 47549; http://n2t.net/addgene:47549; RRID:Addgene_47549) (Dickinson et al ...
-
bioRxiv - Developmental Biology 2021Quote: ... Injection mixes were prepared in MilliQ H2O and contained 50 ng/ml Peft-3::cas9 (Addgene ID #46168) (Friedland et al. ...
-
bioRxiv - Synthetic Biology 2019Quote: ... The human codon-optimized Cas9 coding sequence including two nuclear localization signals (SV40 NLS at the 5’ and nucleoplasmin NLS at the 3’) was amplified from hcas9 (a gift from George Church; Addgene plasmid # 41815; http://n2t.net/addgene:41815; RRID:Addgene_41815) using primers βtub85Dtub85D-cas9-F/cas9-βtub85Dtub56D-3’UTR-R (Mali et al ...