Labshake search
Citations for Addgene :
251 - 300 of 829 citations for Protein DNA Interaction Assay since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... was mixed with 4 μg of DNA RV helper plasmid (Addgene, plasmid #12371), in 1800 μl of Opti-MEM reduced serum medium (ThermoFisher ...
-
bioRxiv - Cell Biology 2019Quote: The DNA construct expressing dsRed-centrin2 (Tanaka, et al., 2004) (Addgene plasmid 29523) was a generous gift from Dr ...
-
bioRxiv - Biochemistry 2019Quote: The full length DNA encoding NRBF2 was cloned into vectors 1M (Addgene #29565), generating His6-MBP-TEV-NRBF2 ...
-
bioRxiv - Bioengineering 2021Quote: ... 2 μL of plasmid DNA (tdTomato-Lifeact-7, 500 ng/ μL, Addgene, 54528), and 96 μL of PBS ...
-
bioRxiv - Neuroscience 2020Quote: The DNA fragment of LoxP-Stop-LoxP (a gift from Takuji Iwasato (Addgene plasmid # 69138 ...
-
bioRxiv - Neuroscience 2020Quote: The DNA fragment of H2B-mEos4b-6 (a gift from Michael Davidson (Addgene plasmid # 57508 ...
-
bioRxiv - Cell Biology 2020Quote: ... and corresponding DNA oligos were ligated into pCRISPR-Lenti-v2 (Addgene #52961 (45)) as described ...
-
bioRxiv - Cell Biology 2022Quote: ... shRNA construct along with two helper DNA constructs (pHR-CMV8.2 deltaR (Addgene 8454) and pCMV-VSVG (Addgene 8455) ...
-
bioRxiv - Molecular Biology 2019Quote: ... The ERT2 DNA fragment was PCR amplified from pCAG-Cre-ERT2 (Addgene #14797) using 1Fw and 1Rv primers and inserted between SalI and BamHI sites of pBudCE4.1-3xHA ...
-
bioRxiv - Cell Biology 2020Quote: ... The corresponding guide DNA sequences were cloned into the lentiCRISPRv2 plasmid (Addgene #52961) according to the instructions of the Zhang laboratory (https://www.addgene.org/52961)31 ...
-
bioRxiv - Neuroscience 2021Quote: ... and donor DNA plasmid containing a neomycin-resistance cassette (adapted from Addgene, PL552). Transfected cells were selected with neomycin for one week ...
-
bioRxiv - Cell Biology 2020Quote: ... The gBlock DNA was inserted into pCSCMV:tdTomato (a gift from Gerhart Ryffel, Addgene plasmid #30530 ...
-
bioRxiv - Cancer Biology 2022Quote: DNA plasmids were constructed using the pLX302 and pLX304 Gateway system (Addgene, #25890). Briefly ...
-
bioRxiv - Cancer Biology 2022Quote: ... DNA oligonucleotides were annealed and ligated into the lentiGuide-Cherry vector (Addgene # 170510) at the BsmBI restriction enzyme cutting sites ...
-
bioRxiv - Molecular Biology 2022Quote: ... CRISPR-Prime Editing system encoding lentiviral pLenti-PE2-BSD plasmid DNAs (Addgene, # 161514) encoding CRISPR-PE containing the blasticidin resistance gene ...
-
bioRxiv - Biophysics 2023Quote: DNA was synthesized from a Widom 601 sequence containing plasmid pGEMz_601 (Addgene, 26656) with primers containing a biotin and Cy3 ...
-
bioRxiv - Cell Biology 2023Quote: ... The mCherry-Cry2 constructs were made by amplifying mCherry-Cry2 DNA from Addgene plasmid #101221 (gift from Brangwynne) ...
-
bioRxiv - Cell Biology 2022Quote: ... The corresponding guide DNA sequences were cloned into the lentiCRISPRv2 plasmid (#52961; Addgene) according to the instructions of the Zhang laboratory (https://www.addgene.org/52961/) ...
-
bioRxiv - Genetics 2023Quote: ... or an EcoRI-digested pLKO.1 backbone using T4 DNA ligase (Addgene #8453). To generate intein-split PE plasmids ...
-
bioRxiv - Synthetic Biology 2023Quote: ... We used DNA parts provided with the EMMA cloning kit (Addgene kit # 1000000119) and generated DNA fragments by PCR using Platinum™ SuperFi II Green PCR Master Mix (ThermoFisher ...
-
bioRxiv - Cell Biology 2023Quote: ... the DNA sequence of μNS was obtained from pRS306-PHIS3-GFP-μNS (Addgene plasmid #116935 ...
-
bioRxiv - Immunology 2024Quote: ... Synthesized double stranded DNA fragments were then cloned into AbVec2.0-IGHG1 (Addgene #80795), AbVc2.0-1.1-IGKC (Addgene #80796) ...
-
bioRxiv - Cancer Biology 2019Quote: Reporter assays were performed as described previously (Ferreira et al., 2017) using the DR5 reporter construct obtained from Addgene (Plasmid 16012 (Takimoto & El-Deiry ...
-
bioRxiv - Biochemistry 2023Quote: Luciferase reporter assays were performed in MEF cells transfected with a UCP3 reporter plasmid[18] (UCP3 EP1, Addgene #71743) or PGC-1α 2kb promoter (Handschin et al ...
-
bioRxiv - Cell Biology 2019Quote: ... the Pro251 allele was inserted into the green fluorescent protein (GFP)-PLIN2 plasmid (Addgene #87161). Sequences were verified in forward and reverse directions using primers EGFP-N and SV40pA-R ...
-
bioRxiv - Neuroscience 2020Quote: ... and the fluorescent protein cDNA for tagBFP was cloned from pdCas9::BFP-humanized (Addgene, #44247). A zebra finch FoxP2 cDNA clone provided by Erich Jarvis was subcloned into pLenti6.4 using a gateway reaction ...
-
bioRxiv - Biophysics 2020Quote: ... final protein expression constructs were generated by Gateway LR recombination into pDest-566 (Addgene #11517), an Escherichia coli T7–based expression vector based on pET42 and incorporating hexa-histidine (His6 ...
-
bioRxiv - Biophysics 2022Quote: ... pET19b:EcMscLGFP was used previously as an in vitro membrane protein folding reporter (Addgene plasmid # 165097) (Jacobs et al. ...
-
bioRxiv - Biochemistry 2022Quote: ... Expression constructs for various cytoskeleton or organelle marker proteins were obtained from Addgene (S1 Table). For bacterial expression of His6-tagged CAHS proteins ...
-
bioRxiv - Cell Biology 2021Quote: MSCs were transduced with lentiviral particles having mitochondria targeting protein and GFP in downstream (Addgene) and lysosome were stained with lysotracker Deep-Red (Invitrogen ...
-
bioRxiv - Neuroscience 2021Quote: HEK293T cells were transfected with an inducible nuclear-localized HT protein (HT-NLS, Addgene #82518). Doxycycline (DOX ...
-
bioRxiv - Neuroscience 2021Quote: ... enhanced yellow fluorescent protein (eYFP) or the single guide RNA (sgRNA) that cleaves KV3.4/KCNC4: pENN.AAV.CAG.tdTomato.WPRE.SV40 (Addgene #105554), pAAV.CamKII(1.3).eYFP.WPRE.hGH (Addgene #10522) ...
-
bioRxiv - Cell Biology 2020Quote: ... or a fluorescent protein (pCDNA3-GFP; Addgene plasmid #74165 or mCherry2-N1; Addgene plasmid #54517) was used to transfect HEK-293 cells at 70-90% confluency using Lipofectamine 3000 reagent (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2019Quote: ... an artificial transposon with all of the attributes of a protein expression vector (Addgene #120863), and 1 unit of MuA transposase (Thermo Fisher Scientific ...
-
bioRxiv - Synthetic Biology 2020Quote: The extracellular domain of ASLV-A envelope protein from the plasmid pAAV-TRE-HTG (Addgene) and the targeting domain encoding the Gbp6 nanobody33 were combined by PCR and cloned into a Piggybac transfer vector under a synthetic constitutive promoter (Supplementary Table 1) ...
-
bioRxiv - Immunology 2022Quote: MSP2N2-His6 protein (45) was expressed by transforming BL21 DE2 cells with pET28-MSP2N2 (Addgene). Cells were grown to a OD600 of ~0.8 in the presence of 50 μg/mL of kanamycin and induced for 3 hours with 0.5 mM isopropy β-D-1-thiogalactopyranoside (IPTG) ...
-
bioRxiv - Microbiology 2022Quote: ... to co-transfect plasmids containing cDNAs for SARS-CoV-2 E protein (pGBW-m4133502, Addgene) and green fluorescent protein (GFP ...
-
bioRxiv - Molecular Biology 2022Quote: Plasmid pET28HIS-hAPE1 (for WT His-APE1 protein) was a gift from Primo Schaer (Addgene plasmid #70757 ...
-
bioRxiv - Microbiology 2023Quote: HEK293 cells expressing transiently-transfected actin fused to monomeric azure-fluorescent protein (mAzure-Actin; Addgene) were grown on coverslips in 12-well plates at 2×105 cells/well and infected with Bp340 ...
-
bioRxiv - Molecular Biology 2023Quote: ... or Wnt7a-BioID2 fusion proteins were generated using the mycBioID2-pBABE-puro vector (Addgene Plasmid). Myoblasts were grown in 15 cm culture dishes at sub confluency and incubated with biotin (Sigma-Aldrich ...
-
bioRxiv - Biophysics 2023Quote: TIA1 proteins were expressed in the BL21DE3 bacterial cell line from the pET28b plasmid (Addgene) containing the Mus musculus (mouse ...
-
bioRxiv - Biochemistry 2023Quote: ... 0.85 μg pVSV-G (Expresses VSV-G envelop protein for pseudotyping NanoMEDIC particle, Addgene #138479) (46) ...
-
bioRxiv - Neuroscience 2023Quote: ... USA) and [2] a Cre-dependent virus expressing green fluorescent protein (AAV-Flex-GFP; Addgene) or diphteria toxin (AAV2/9-EF1a-mCherry-Flex-dTA ...
-
bioRxiv - Cell Biology 2023Quote: ... Both GFP11-tagged Fluc proteins and GEM transcriptional factor (cloned from pJW1663, Addgene plasmid #112037) were stably integrated into yeast genome ...
-
bioRxiv - Cell Biology 2023Quote: ... a vector expressing dCas9-VP64 fusion protein based on pCMV-SpdCas9-VP64 (Addgene plasmid # 115794), a gift from Nadav Ahituv 62 ...
-
bioRxiv - Bioengineering 2023Quote: ... a red fluorescent calcium sensor protein (RCaMP) was amplified from pAAV.Syn.Flex.NES-jRGECO1a.WPRE.SV40 (Addgene cat#100853) using primers 5’-ACTAGTATGCTGCAGAACGAGCTTGC and ACCGGTCTACTAGTCTCAATTGTCACTTCGCTGTCATCATTTGT ...
-
bioRxiv - Molecular Biology 2021Quote: ... a DNA fragment containing 5′-AGCCATGGGAAACATCGCAC-3′ was cloned into pL-CRISPR.EFS.tRFP (Addgene#57819) (Heckl et al. ...
-
bioRxiv - Immunology 2019Quote: ... DNA sequence encoding microRNA-722 tagged with Dendra2 were amplified from (Addgene plasmid # 97163) with the following primers ...
-
bioRxiv - Cell Biology 2021Quote: ... the cassettes were cloned via NEBuilder® HiFi DNA Assembly into AAVS1_SA_2A_Neo_CAG_RTTA3 (Addgene, #60431) (Sim et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... DNA fragment of mito-mNep2-FLAG (mNeptune2-N1, a gift from Michael Davidson (Addgene plasmid # 54837 ...