Labshake search
Citations for Addgene :
251 - 300 of 1379 citations for Human Low affinity immunoglobulin gamma Fc region receptor II c FCGR2C ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... [14] and low-titer Cre (AAV9-hSyn-Cre-WPRE-hGH; Addgene #105553, MOI = 5×103 vg) AAVs on DIV 7 ...
-
bioRxiv - Neuroscience 2023Quote: ... 6 × 107 RPE1 cells were infected with the human sgRNA library (Human GeCKO v2 Library Cat#1000000048, Addgene) at an MOI of ∼0.3 ...
-
bioRxiv - Biochemistry 2020Quote: ... pDEST26-C-FLAG (Addgene #79275) [22] vector ...
-
bioRxiv - Biochemistry 2022Quote: ... mEmerald-JUP-C-14 (Addgene plasmid # 54132 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and c-Met (Addgene; 31784) plasmids were purchased from Addgene ...
-
bioRxiv - Molecular Biology 2023Quote: ... pOPARA2 or pPGC-C (Addgene plasmid # 174580 ...
-
bioRxiv - Microbiology 2021Quote: ... a 20 nucleotide guide RNA (gRNA) sequence targeting the IRF7 protein-coding region was inserted into the lentiCRISPRv2 vector (Addgene; catalog #52961). The IRF7 guide sequences used was ...
-
bioRxiv - Developmental Biology 2020Quote: ... DBD and AD sequences along with the Drosophila synthetic minimal core promoter (DSCP) region were amplified using PCR from vectors pBPZpGal4DBDUw and pBPp65ADZpUw (Addgene clone 26234) using primers that added NotI and AvrII restriction sites (CTGATCGCGGCCGCAAAGTGGTGATAAACGGCCGGC and GATCAGCCTAGGGTGGATCTAAACGAGTTTTTAAGCAAACTCAC) ...
-
bioRxiv - Developmental Biology 2020Quote: ... targeting the 5’ (5’-AGTGCGCTTCGTCACTGCAC-3’) and 3’ (5’-TCCTCCCGCCCCGACGCGGA-3’) region of the Spen ORF were cloned in the Cas9-GFP pX458 vector (Addgene plasmid #48138). Compatible 5’ and 3’ Homology arms (HA ...
-
bioRxiv - Cell Biology 2022Quote: Guide RNA designed to cut close to the 70-nucleotide region upstream of the ADC17 start codon (agtaacataatgtgctcagcagg) was inserted into pML104 (Addgene number: 67638) to generate pML104-ADC17-70nt ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 + 3 gRNAs targeting either side of the +3 kb enhancer core region (targeting sequences listed in Supplementary Table 2) were cloned into pX330 vector (Addgene plasmid #42230). mESCs were co-transfected with a mixture of all 6 CRISPR plasmids and a plasmid containing a blasticidin expression cassette for selection ...
-
bioRxiv - Biophysics 2020Quote: The plasmid containing 1.6 kb telomeric TTAGGG repeats with a 23-bp interruption linking two (TTAGGG) 135 regions (T270, 5.4 kb) was purchased from Addgene (plasmid pSXneo(T2AG3), #12403 ...
-
bioRxiv - Cell Biology 2022Quote: ... expressing myristoylated FGFR1 cytoplasmic region fused with the PHR domain of cryptochrome2 and mCitrine (gift from Won Do Heo (Addgene plasmid # 59776), (Kim et al. ...
-
bioRxiv - Pathology 2019Quote: ... antisense: CGAGTTCATGACGGCGCGCA) targeting the DID domain region of INF2 was expressed using a lentiviral plasmid (Cat. no:5296, lentiCRISPRV2, Addgene, Boston, MA). All cloned plasmids were confirmed for the correct sequence by DNA sequencing (Genewiz ...
-
bioRxiv - Neuroscience 2021Quote: ... Adjacent 2kb 5’ and 3’ homology regions were cloned into pHD-DsRed-attP (gift from Melissa Harrison & Kate O’Connor-Giles & Jill Wildonger, Addgene plasmid # 51019, RRID:Addgene_51019) 5’ region via EcoRI/NotI ...
-
bioRxiv - Biophysics 2020Quote: ... targeting the coding region of ASIC1 was cloned into Bbsl-linearized pSpCas9(BB)-2A-GFP vector (a kind gift from Feng Zhang, Addgene plasmid #48138) as previously described25 ...
-
bioRxiv - Bioengineering 2022Quote: ... we generated 2 sgRNA plasmids each harboring 2 distinct sgRNAs targeting the promoter regions of eve (AAEL007369, OA-1053A, Addgene plasmid #184006) and hh (AAEL006708 ...
-
bioRxiv - Cell Biology 2022Quote: ... was created by cloning the mitochondria-localized mCherry-GFP1-10 region from plasmid MTS-mCherry-GFP1-10-Hyg-N15 (Addgene Plasmid #91957) into a lentiviral backbone with an EF-1α promoter driving the expression ...
-
bioRxiv - Molecular Biology 2022Quote: ... The pAAV-EF1a-FLuc plasmid was generated by replacing the TdRed sequence in pAAV-EF1a-TdRed (unpublished, see below) with the FLuc gene with the regulatory WPRE region from pAAV-CAG-FLuc (Addgene Cat# 83281). Restriction enzymes BamHI-HF and SalI-HF were used to release the 3.4 kb vector band from pAAV-EF1a-TdRed as well as the 2.3kb FLuc-WPRE sequence from pAAV-CAG-FLuc ...
-
bioRxiv - Cell Biology 2023Quote: Two small gRNA (#1-GGGGTATTTCAATCAGAAGC; #2-ACGGGAAGCGCACAGTTTAT) targeting msps genomic region were synthesized and inserted into the pCFD5 vector (74) (Addgene, Plasmid #73914) via BbsI digestion ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... were cloned into pCFD4 (Addgene plasmid 49411)57 and the 1kb regions upstream and downstream of the cut sites were cloned into vector pHD-attP-DsRed (Addgene plasmid 51019)58 ...
-
bioRxiv - Developmental Biology 2023Quote: ... sgRNAs 5’-CCCCATGGACATACCCACTG-3’ and 5’-CCAGTCGAGCAGAAAAGTGT-3’ defining a 244 bp region in Nodal exon 2 were cloned into pX458 (Addgene plasmid #48138) or pX459 (Addgene plasmid #48139 ...
-
bioRxiv - Cell Biology 2021Quote: ... CMV-GFP-NMHC II-B (Addgene plasmids # 11347, 11348)(Wei and Adelstein ...
-
bioRxiv - Cancer Biology 2023Quote: ... (ii) HEK293T with 1.3 μg of psPAX2 (Addgene, #12260), 0.8 μg of pVSVG (Addgene ...
-
bioRxiv - Systems Biology 2021Quote: ... human knockout CRISPR v1 library (Addgene #67989) (39) ...
-
bioRxiv - Microbiology 2021Quote: The human CRISPR Brunello library (Addgene 73178) (16 ...
-
bioRxiv - Cell Biology 2023Quote: ... from human pcDNA3.1-2xFLAG-SREBP1a (#26801, Addgene), pcDNA3.1-2xFLAG-SREBP1c (#26802 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Human Sin1.1 was PCR-amplified from Addgene 73388 plasmid (gift from Taekjip Ha32 ...
-
bioRxiv - Biochemistry 2024Quote: ... and recombinant human GST-CK2α (Addgene #27083) enzymes were produced in-house as previously described [30] ...
-
bioRxiv - Microbiology 2024Quote: ... The human RAB6Q72L was subcloned from Addgene plasmid #49483 into a bacteria expression pGEX-4T-1 vector encoding a N-terminal GST tag followed by a TEV cleavage site.
-
bioRxiv - Biophysics 2022Quote: The plasmid encoding GPCR kinase subtype 2 used for the receptor phosphorylation in insect cells (GRK2-CAAX) was a gift from Robert Lefkowitz (Addgene plasmid #166224 49). Full-length arrestin21-418 (C150L ...
-
bioRxiv - Neuroscience 2021Quote: ... The BoxB reporter was pAc5.1C-Fluc-Stop-5BoxB (a gift from Elisa Izaurralde; Addgene plasmid #21301) (Behm-Ansmant et al. ...
-
bioRxiv - Cancer Biology 2023Quote: An XRN1 open-reading frame (ORF) clone deposited by Elisa Izaurralde was purchased from Addgene (#66596). The entire ORF was sequenced to confirm fidelity to the NCBI Reference Sequence NM_019001.5 ...
-
bioRxiv - Microbiology 2019Quote: ... We introduced a single guide RNA (gRNA) targeting the 3’ region of the TgApiAT1 locus into the vector pSAG1::Cas9-U6::sgUPRT (Addgene plasmid # 54467; [34]) using Q5 site-directed mutagenesis (New England Biolabs ...
-
bioRxiv - Biochemistry 2022Quote: ... Plasmids used for mammalian one-hybrid experiments included segments of the β-catenin coding region cloned into pCMV-GAL4 vector (gifted by Liqun Luo (Addgene plasmid # 24345)) to create pGAL4-βCAT plasmids ...
-
bioRxiv - Cancer Biology 2023Quote: ... The sgRNA oligos targeting the different genomic regions of HOTAIR gene were synthesized and cloned into the BbsI site of PX548 (Addgene, Cat. No: 48138) construct following manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV-JET-DIO-Nb-Ft-TRPV1Cl- and pAAV-JET-DIO-TRPV1Ca2+ and was made by replacing the BsrGI/NheI region of pAAV-hSyn-DIO-hM3D(Gq)-mCherry (Addgene Cat No. 44361) with a multiple cloning site (TGTACAACTAGTACCGGTTCGCGAGCATGCCCTAGGGCTAGC ...
-
bioRxiv - Cell Biology 2022Quote: ... containing the sgRNA sequence targeting the coding region of the sec11a and sec11c genes were inserted into the pSpCas9(BB)-2A-Puro (PX459) vector (#48139; Addgene, Watertown, MA, USA) (digested with BbsI ...
-
bioRxiv - Biochemistry 2024Quote: ... NM_018344.6 (SLC29A3):c.1427A>G (p.Ter476Trp) and NM_000343.4(SLC5A1):c.1993T>C (p.Ter665Arg)) were cloned into pCDNA3.1-HA (Addgene 128034) using Gibson assembly ...
-
bioRxiv - Cell Biology 2022Quote: ... having N of human coronavirus OC43 and pGBW-m4134901 (plasmid number 151922) having N of human coronavirus HKU1 229E were obtained from Addgene. Those N expression vectors were subcloned into pcDNA3.1 with C-terminal flag or EGFP tag ...
-
bioRxiv - Cancer Biology 2022Quote: ... encoding human KDM6A with HA tag and pCS2-UTX-F-MT2 (40619) encoding enzyme-dead human KDM6A were purchased from Addgene. The HR and NHEJ reporter plasmids were kind gifts from Tomasz Skorski (61) ...
-
bioRxiv - Cell Biology 2021Quote: ... pMXs-c-Myc (Addgene Plasmid #13375) per 10 cm dish using Fugene 6 (Catalog# Promega# E2691) ...
-
bioRxiv - Cancer Biology 2020Quote: ... pT3-EF1a-c-Met (31784, Addgene) or pCMV-Hygro-LINC01510 (Twist Bioscience ...
-
bioRxiv - Cell Biology 2021Quote: ... mEmerald-actin-C-18 (Addgene #53978), and mApple-paxillin-22 (Addgene #54935) ...
-
bioRxiv - Cell Biology 2020Quote: ... mCardinal-H2B-C-10 (Addgene #56162)11 ...
-
bioRxiv - Cancer Biology 2022Quote: mCherry-Lamin A/C (Addgene #55068) and mCerulean-Lamin B1 (Addgene #55380 ...
-
bioRxiv - Biochemistry 2021Quote: ... C-terminal MBP plus His6 (Addgene_37237); N-terminal His6 plus glutathione S-transferase (GST ...
-
bioRxiv - Cancer Biology 2021Quote: ... or C-Flag-Rela (Addgene #20012) using 25μL Lipofectamine and 4.5μg plasmid DNA in 600μL Optimem total ...
-
bioRxiv - Cancer Biology 2021Quote: The human MYC cDNA was purchased from Addgene (pDONR223_MYC_WT ...
-
bioRxiv - Molecular Biology 2019Quote: ... and a human codon-optimized Cas9 (Addgene 41815) were co-nucleofected into target cells by nucleofection (Lonza apparatus) ...