Labshake search
Citations for Addgene :
201 - 250 of 1379 citations for Human Low affinity immunoglobulin gamma Fc region receptor II c FCGR2C ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... The original CRISPRoff plasmid DNA (except the region encoding TagBFP) and mScarletI cDNA from the pmScarlet-i_C1 plasmid (Addgene # 85044) were amplified by polymerase chain reaction (PCR ...
-
bioRxiv - Cell Biology 2023Quote: ... The RAD52KO cell line was generated from the RAD52WT line by CRISPR-Cas9-mediated deletion of the 1.1kb region between exons 3 and 4 using guide RNAs sg1 and sg2 cloned into px330 (Addgene #42230) as previously described (Kelso et al ...
-
bioRxiv - Microbiology 2023Quote: ... Truncation mutations in NL4-3 were created by subcloning the region of NL4-3 between EcoRI to XhoI into pBlueScript KS(-) (Addgene), followed by site-directed mutagenesis to introduce a stop codon to generate the desired truncation mutation ...
-
bioRxiv - Neuroscience 2023Quote: ... we inserted a barcode sequence consisting of 20 random nucleotides in the 3’ untranslated region of the nucleoprotein gene in pRVΔG-4mCherry (Addgene #52488) (SAD B19 strain ...
-
bioRxiv - Cancer Biology 2019Quote: ... sequence (5’-TGAAAGCCACCAGACCTCGA) targeting exon 8 of the murine leptin receptor (LepR) was ligated into the BsmBI site in lentiGuide-Puro (Addgene 52963) with compatible annealed oligos to generate lentiGuide-Puro-sgLepR ...
-
bioRxiv - Bioengineering 2020Quote: ... The ScFv library with the N-terminal CD8α signal peptide was fused to the synNotch-Gal4VP64 receptor backbone (Addgene plasmid #79125) in place of the CD19-specific scFv ...
-
bioRxiv - Molecular Biology 2020Quote: ... Immortalized Smarca4AID/AID preadipocytes were infected with retroviral vector expressing the auxin receptor Tir1 of rice (pBabePuro-OsTir1-9Myc, Addgene #80074). To induce degradation of SMARCA4 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Enhanced serotype inhibitory Designer Receptors Exclusively Activated by Designer Drugs (DREADD) vectors used were AAV-PHP.eB-hSyn-DIO-hM4D(Gi)-mCherry (Addgene #44362, ME) (Chan et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... sapiens beta-2-adrenergic receptor used as a control in BRET2 experiments was a gift from Robert Lefkowitz (Addgene plasmid #14697). Mm Arr-2 (NP_796205.1 ...
-
bioRxiv - Neuroscience 2024Quote: ... we cloned CreERT2 (Cre recombinase fused to a mutant ligand-binding domain of the estrogen receptor) and IRES into the BamHI site of pAAV-EF1a-tdTomato-WPRE-pGHpA (Addgene #67527). To prevent leakage of Cre activity34 ...
-
bioRxiv - Developmental Biology 2021Quote: ... GST-human β-catenin (Addgene #24193), and NLS-mCherry (Addgene #49313 ...
-
bioRxiv - Molecular Biology 2022Quote: ... pscALPSpuro-HsACE2 (human) (Addgene, MA, USA) were co-transfected with psPAX2 and pCMV-VSV-G packaging plasmids into HEK293T cells using FuGENE 6 (Promega ...
-
bioRxiv - Neuroscience 2023Quote: ... human a-SYN (A53T mutant) (Addgene), and mt-Keima (Addgene) ...
-
bioRxiv - Biochemistry 2024Quote: Recombinant human GST-CK2α’ (Addgene #27084) and recombinant human GST-CK2α (Addgene #27083 ...
-
bioRxiv - Cancer Biology 2024Quote: ORF encoding human MARK2 (Addgene, 23404) was cloned into pFL system with an N-terminal Strep2SUMO tag ...
-
bioRxiv - Cancer Biology 2023Quote: ... HPAF-II cells stably expressing FUCas9Cherry (Addgene#70182) were transduced with MSMO1 sg RNA or FAXDC2 sgRNA along with pMD2.G (Addgene #12259 ...
-
bioRxiv - Neuroscience 2022Quote: ... was digested with NheI/KpnI and ligated with similarly digested pPD96.52 (Fire lab C. elegans Vector Kit 1999; 1608: L2534, Addgene) to generate pKMC166 (myo-3p::mCherry) ...
-
bioRxiv - Microbiology 2023Quote: ... Pmyo-3::mCherry] by cloning 1397bp promoter and 1266bp coding sequence of col-51 in frame with GFP into the vector pPD95.77 (Fire Lab C. elegans vector kit; Addgene) and microinjecting to N2 worms.
-
bioRxiv - Neuroscience 2023Quote: ... were cloned by PCR amplification of the full-length human GPCR cDNA library (hORFeome database 8.1) or the PRESTO-Tango GPCR Kit36 (Addgene Kit #1000000068). To optimize the 5-HT sensors ...
-
bioRxiv - Genomics 2020Quote: ... a total of 4 guides flanking the region to be deleted (2 on each side) were cloned into the pX459-v2 vector (Addgene #62988) (Ran et al. ...
-
bioRxiv - Cancer Biology 2019Quote: To obtain stable knockdowns of PTEN and RB (in-house-designed) shRNA sequences targeting specific regions within the respective mRNA were cloned into the lentiviral vector pLVTHM (Addgene#12247) carrying mCherry or GFP as mammalian selection marker ...
-
bioRxiv - Cell Biology 2019Quote: ... Two gRNA sequences targeting different regions of linc00899 (guide 1 and 2) were cloned into pU6-sgRNA EF1Alpha-puro-T2A-BFP (Addgene, #60955). All clones were verified by Sanger sequencing using mU6 forward primers (Supplementary Methods) ...
-
bioRxiv - Biochemistry 2020Quote: An sgRNA sequence (5’-GCCCAATTCAGAGAGACATG-3’) targeting the genomic region immediately downstream the CDK12 start codon was cloned into the PX458 vector (Addgene 48138). The 3xFLAG knock-in repair template was constructed in a pTOPO-TA vector (Mei5bio ...
-
bioRxiv - Bioengineering 2021Quote: ... nanobody sequences were PCR amplified with primers containing terminal regions of homology for cloning into a pRset plasmid (Addgene plasmid 3991)(Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: ... which contained: flanking sequences of the YKL075C gene and the KanMX6 coding region from the plasmid pFA6-KanMX6 (Addgene, Watertown MA). All transformations were carried out using the lithium acetate and transformants were identified as colonies that grow on selective solid media ...
-
bioRxiv - Cancer Biology 2019Quote: ... in the leucine zipper region of the bZIP domain by site-directed mutagenesis of the pBabe mRFP1-NRF2 hygro plasmid (Addgene #136579) originally prepared by subcloning into pBabe mRFP1 hygro ...
-
bioRxiv - Developmental Biology 2022Quote: ... Plasmids containing coding regions for the fast-folding fluorescent proteins sCFP3A and Venus/YFP (Balleza et al., 2018) were obtained from Addgene (www.addgene.org). Partial or complete coding regions for Can-elt-3 ...
-
bioRxiv - Neuroscience 2021Quote: ... which was generated by replacing a cassette of a ccdB gene and attR1 and attR2 sites with the coding region of AAV-EF1α-DIO-PSD95.FingR-EGFP-CCR5TC (Addgene #126216)18.
-
bioRxiv - Cell Biology 2022Quote: ... homology recombination cassettes containing the desired knock-in DNA with flanking regions of homology of 1075 bp to the target locus were co-transfected with a version of pSpCAS9(BB) (Addgene, 48139) containing the guide RNA sequence 5’-TCTTTGATGCTAGTTAAAGT-3’ and modified to removed puromycin resistance ...
-
bioRxiv - Pathology 2019Quote: ... of 5’ UTR and 3’ UTR regions were PCR amplified and ligated sequentially to flank the ILV2SUR sulfonylurea-resistance cassette in pFGL820 (Addgene, 58221) (Figure S2a) ...
-
bioRxiv - Neuroscience 2019Quote: ... pAAV-hSyn-OsTIR1-P2A-mAID-EGFP construct was synthesized by replacing cording region of the pAAV-hSyn-EGFP (Addgene plasmid #50465) with the OsTIR1-P2A-mAID-EGFP-NES sequence OsTIR1-p2A-mAID-EGFP-NES sequence was amplified by PCR from pAY8 using following primers ...
-
bioRxiv - Neuroscience 2019Quote: Mice were anesthetized with an intraperitoneal injection of ketamine-dexmedetomidine and received bilateral intra-CA1 injections of a guide RNA expression vector driven by the murine U6 promoter and targeting the murine Neat1 promoter region (Addgene #44248) either alone or in conjunction with an expression vector coding for the S ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Synthetic and control promoter parts were assembled with the omega 5’ untranslated region from tobacco mosaic virus (5UTR-ΩTMV; pICH41402, Addgene #50285), the coding sequence of firefly luciferase (LucF ...
-
bioRxiv - Immunology 2021Quote: ... the Cas9 endonuclease and a single guide RNA (sgRNA) targeting the region in which the base pair change was expected to take place (Addgene 62988). The single stranded donor oligonucleotide (ssODN ...
-
bioRxiv - Biochemistry 2020Quote: ... the coding region of the SunTag and Kif18b was obtained by PCR of a pCMV-SunTag-Kif18b-PP7 template (Addgene #128606), using the following primers ...
-
bioRxiv - Genomics 2021Quote: ... a primer binding site and restriction sites for SgsI and SdaI into the Bsp1704I site at the 3’ end of the GFP coding region of pcDNA3-EGFP (Addgene #13013). The modified plasmid was cut with SgsI and SdaI (Fermentas FastDigest ...
-
bioRxiv - Biochemistry 2021Quote: ... 30 base regions of the dnaB gene (S1 Table) targeting the mutation site were inserted into the pCRISPR plasmid (Addgene: 42875) as a guide RNA (gRNA ...
-
bioRxiv - Cell Biology 2021Quote: ... Different sgRNA sequences targeting promoter region of Smpdl3b (Table S4) were cloned into plasmid pSLQ1651-sgRNA(F+E)-sgGal4 (Addgene #100549) and then were packed into lentivirus ...
-
bioRxiv - Molecular Biology 2022Quote: Lentiviral plasmids expressing rABE or APOBEC1 were generated by inserting the deaminase region into pSLIK-TT-RBFOX2 plasmid backbone (Addgene #59770) with Gibson cloning ...
-
bioRxiv - Plant Biology 2022Quote: The Tet-Off system was engineered by fusing the promoter and coding region of MoVps35 to pFGL1252_TetGFP(Hyg) vector (Addgene ID 118992), which contains a specific Tet-off cassette activated by tetracycline or doxycycline ...
-
bioRxiv - Cell Biology 2023Quote: ... Mapt exon 4 and flanking the intron regions were PCR amplified using Phusion High-Fidelity DNA polymerase and inserted into NheI/BamHI digested pFlareA Plasmid (Addgene, 90249) and sequenced ...
-
bioRxiv - Plant Biology 2023Quote: ... Guide RNA targeting a unique region of OsCLSY3 gene at 1st exon (UCCUCUCGGCCCUCCAACAG) was cloned into pRGEB32 vector (Addgene Plasmid #63142) (Xie and Yang ...
-
bioRxiv - Cancer Biology 2023Quote: A double cutting CRISPR/Cas9 approach with a pair of sgRNAs (sgRNA A and B) was used to completely excise exon 2 (322 bp region) of DYRK1A using a px458 vector (Addgene #48138) that was modified to express the full CMV promoter ...
-
bioRxiv - Developmental Biology 2023Quote: A sgRNA targeting the arginine finger region of SYNGAP1 was cloned into pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene plasmid #62988). This ...
-
bioRxiv - Neuroscience 2023Quote: ... An additional round of CRISPR/Cas9 genome editing was performed on one clonal cell line to further disrupt the coding region of endogenous Scn9a using recombinant pX458 plasmid (pSpCas9-2A-GFP; Addgene #48138) and a gRNA targeting the in-frame deletion (Scn9a ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... guides targeting the sequence in the same intergenic region utilized by the ttTi5650 MosSCI site have previously been described (Dickinson et al., 2015) and inserted into pDD162 (Addgene #47549) to make plasmid pMS4 ...
-
bioRxiv - Cancer Biology 2023Quote: Two sets of gRNAs targeting either exon 3 or exon3-7 of IL1R1 coding region were cloned in PX459 (Addgene 62988) and co-transfected in HT1080 cells ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2018] genomic DNA using RLO336/RLO338 and RLO337/RLO339 primers (Table 2) which introduce sequences homologous to the regions flanking the SacI and HindIII sites of pRG216 (Addgene #64528) [Gnügge and Rudolf 2017] ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: After co-transfection for 36 hours with plasmid DNA encoding the relevant SNAP-tagged receptor (1 μg) and AKAR4-NES (1 μg; a gift from Dr Jin Zhang, Addgene plasmid #647270), wild-type or dual β-arrestin knockout HEK293 cells were suspended in HBSS in black 96 well plates ...
-
bioRxiv - Cancer Biology 2022Quote: ... pTag-RFP-C-h-Rab11a-c-Myc was a gift from James Johnson (Addgene plasmid #79806 ...