Labshake search
Citations for Addgene :
2551 - 2600 of 3780 citations for 6 9 Ethano 4H imidazo 4 5 d pyridazino 1 2 a pyridazin 4 one 2 butyl 3 6 7 8 9 11 hexahydro 6 9 dimethyl 3 2' 2H tetrazol 5 yl 1 1' biphenyl 4 yl methyl since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2023Quote: ... the StuI and XmaI restriction sites in plasmid pENTR4-HaloTag (Addgene #W876-1) were changed into a silent mutation following standard cloning techniques using primers TL-019-TL-020 and TL-023-TL-024 ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV2/1-DIO-EF1α-mKate2-biPAC (Boston Children’s Hospital Vector Core; Addgene 169127) was unilaterally injected in the PVH of MC4R-2A-Cre mice (150 nl ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV2/1-DIO-EF1α-mKate2-biPAC55 (Boston Children’s Hospital Vector Core; Addgene 169127) and AAV2/1-hSyn-DIO-GreenDownwardcADDis (Boston Children’s Hospital Vector Core ...
-
bioRxiv - Cancer Biology 2023Quote: pLKO-Tet-puro-hRAF1-shRNA-1 was a gift from Ayaz Najafov (Addgene plasmid # 185371 ...
-
bioRxiv - Developmental Biology 2023Quote: ... TIR-1 was amplified from plasmid pLZ31 (Zhang et al., 2015) (Addgene #71720) and cloned under control of the hlh-3 promoter in pSL780 (Bone et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... We injected 50-100 nL of AAV (AAV2/1-Syn-jGCaMP8m-WPRE, Addgene #162375 or AAV2/1-Syn--GCaMP6s-WPRE-SV40 ...
-
bioRxiv - Microbiology 2023Quote: ... The human ANP32A 1-149 construct was a gift from Cynthia Wolberger (Addgene plasmid # 67241 ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV2/1-DIO-EF1α-mKate2-biPAC (Boston Children’s Hospital Vector Core; Addgene 169127), AAV2/1-EF1a-DIO-mKate2-PDE4D3-Cat (Boston Children’s Hospital Vector Core ...
-
bioRxiv - Cancer Biology 2023Quote: Lentiviral gene-specific shRNAs were prepared in pLKO.1-puro backbone (Addgene # 8453) (identified from verified sequences at https://www.sigmaaldrich.com/US/en/product/sigma/shrna ...
-
bioRxiv - Genetics 2023Quote: ... or an EcoRI-digested pLKO.1 backbone using T4 DNA ligase (Addgene #8453). To generate intein-split PE plasmids ...
-
bioRxiv - Neuroscience 2023Quote: ... A viral vector (AAV9.Syn.GCaMP6f.WPRE.SV40; Addgene, 1:10 dilution with PBS and mannitol) was then injected through a thin glass pipette with a micropump (UMP-3 ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV2/1-DIO-EF1α-mKate2-biPAC (Boston Children’s Hospital Vector Core; Addgene 169127) was injected bilaterally into the PVH of MC4R-2A-Cre mice (150 nl ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV2/1-DIO-EF1α-mKate2-biPAC (Boston Children’s Hospital Vector Core; Addgene 169127), together with either AAV1-Syn-Flex-GCaMP6s-WPRE-SV40152 (Addgene 100845-AAV1 ...
-
bioRxiv - Neuroscience 2023Quote: ... guillardia theta anion-conducting channelrhodopsin (stGtACR; hSyn1-SIO-stGtACR2-FusionRed; serotype 1; RRID:Addgene_105677) or eYFP alone as a control (AAV-EF1a-DIO-eYFP ...
-
bioRxiv - Biophysics 2023Quote: ... pLenti CMV rtTA3 Hygro (w785-1) was a gift from Eric Campeau (Addgene plasmid #26730 ...
-
bioRxiv - Cancer Biology 2024Quote: ... DNMT1 and DNMT3B were obtained using lentiviral expression vector pLKO.1 (Addgene #10878) (shRNA sequences are listed in Supplementary Table 1 ...
-
bioRxiv - Neuroscience 2024Quote: ... Recombinant mouse myc-netrin-1 was cloned into pSBI-GN vector (Addgene, 60517) to prepare a stable HEK293 cell line expressing mouse netrin-1.
-
bioRxiv - Neuroscience 2024Quote: Vector used and sources: pAAV5-hsyn-DIO-EGFP (Addgene, Catalog# 50457-AAV 1), pAAV5-FLEX-tdTomato (Addgene ...
-
bioRxiv - Cell Biology 2024Quote: ... pCSII-EF-miRFP670v1-hGem(1/110) was a gift from Vladislav Verkhusha (Addgene plasmid # 80006 ...
-
bioRxiv - Biochemistry 2024Quote: ... and pGEX-6P-1-INTS3-FL (INTS3) were gifts from Yuliang Wu (Addgene plasmids #128307 ...
-
bioRxiv - Cancer Biology 2021Quote: ... pENTR BRAF and pENTR BRAFV600E were gifts from Craig Ceol and pLenti CMV/TO Neo DEST (685-3) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid #17292). To generate pLenti CMV/TO NRASQ61R Neo we performed Gateway cloning to insert NRASQ61R from the donor vector pDONR223 NRASQ61R into the destination vector pLenti CMV/TO Neo Dest ...
-
bioRxiv - Cell Biology 2022Quote: ... sequence 5’-AGC GGC ATG AAG CAC TCA AT-3’ targeting the last coding exon of Fn1 was subcloned downstream the U6 promoter into the PX459 vector (Addgene, cat # 62988) encoding the Cas9-2A-Puromycin cassette (Ran et al. ...
-
bioRxiv - Developmental Biology 2022Quote: HEK293T cells were grown in 10-cm dishes to 80% confluency before transfection with the lentiviral vector (10 µg) with packaging vectors including pMD2.G (3 µg, Addgene plasmid # 12259), psPAX2 (6 µg ...
-
bioRxiv - Developmental Biology 2019Quote: Two plasmids that express the needed gRNAs were made by inserting oligonucleotides (files S11) into the pCFD3-cU6:gRNA plasmid where they would be expressed from the pU6-3 promoter (Addgene plasmid #45946).
-
bioRxiv - Neuroscience 2019Quote: ... These were cloned in parallel into the 3’UTR of the luciferase gene in the pIS-0 vector (12178, Addgene, Cambridge, MA) [27] and DNA extracted and purified ...
-
bioRxiv - Developmental Biology 2021Quote: We grew HEK293T cells in 10-cm dishes to a confluence of 80% before we transfected the lentiviral vector (10 µg) with packaging vectors including pMD2.G (3 µg, Addgene plasmid # 12259), psPAX2 (6 µg ...
-
bioRxiv - Cell Biology 2019Quote: ... 5’ – CCGTTATCCACTTCCAATCCCTCGCAGACAGCGAA TTAATTCCAGCA – 3’ and were designed for overlap with pET His6 TEV LIC cloning vector (1B) (a gift from Scott Gradia, Addgene plasmid #29653). The pET His6 TEV LIC cloning vector (1B ...
-
bioRxiv - Neuroscience 2020Quote: ... CRISPR guide RNA sequence (sgRNA#3 CTCAACACCATCTTCATCCG) targeting the human NLK locus was cloned into pSpCas9 (BB)-2A-GFP (Addgene #481387 PX458). Wild-type iPSCs were transfected with gRNA and Cas9-expressing plasmid using an Amaxa Nucleofector 2b and successfully transfected cells were collected by FACS ...
-
bioRxiv - Genomics 2019Quote: ... were seeded in a 12-well plate and cultured for 24 h before transfection with Sp1-luciferase reporter plasmid DNA (0.5 g; Panomics, Fremont, CA, USA) or a 3× ERE TATA luc construct (Addgene, Cambridge, MA, USA) for 24 h ...
-
bioRxiv - Molecular Biology 2020Quote: ... we infected H9c2s with shRNA against RORα or scrambled shRNA for 48hrs then transfected with an EGFP-Cav-3 plasmid (Addgene plasmid #68396) or empty EGFP plasmid and an mRaspberry-Mito-7 plasmid (Addgene #55931 ...
-
bioRxiv - Cell Biology 2020Quote: ... targeting KIF4A sequence 5’-GCAAGATCCTGAAAGAGAT-3’ was generated using a multipurpose GATEWAY-based lentiviral tetracycline-regulated conditional RNAi system (GLTR) using pENTR-THT-III (Addgene plasmid #55791) and pGLTR-X-Puro (Addgene plasmid #58246 ...
-
bioRxiv - Neuroscience 2021Quote: ... Adjacent 2kb 5’ and 3’ homology regions were cloned into pHD-DsRed-attP (gift from Melissa Harrison & Kate O’Connor-Giles & Jill Wildonger, Addgene plasmid # 51019, RRID:Addgene_51019) 5’ region via EcoRI/NotI ...
-
bioRxiv - Genomics 2020Quote: ... the 3×Flag-BUD13-6HIS fragment was transferred into the pLJM1 lentiviral construct using the NdeI and EcoRI sites (Addgene plasmid # 19319). We produced lentiviruses via co-transfection of pCMV-d8.91 ...
-
bioRxiv - Genomics 2022Quote: ... the genome-wide CRISPR-Cas9/KO Toronto Knockout version 3 library from Hart and team (Hart et al., 2017) (Addgene no. 90294), cloned into the 1 vector system (lentiCRISPRv2 carrying Cas9 and sgRNA expression on the same vector ...
-
bioRxiv - Developmental Biology 2022Quote: ... The PCS2-DCLK-mKO2 plasmid was constructed by amplifying the coding sequences of DCLK1a-202-deltaK (from pT2KXIG-Xef1a-DCLK-GFP, ZFIN ID: ZDB-TGCONSTRCT-090702-3) and mKO2 (from mKOkappa-2A-mTurquoise2, Addgene plasmid # 98837) using gene specific primers with overlapping arms DCLK1a-202_FOR (TGCAGGATCCCATATGGAGGAGCATTTTGACGA) ...
-
bioRxiv - Neuroscience 2023Quote: ... 150nl of AAV2-hSyn-DIO-hM3D(Gq)-mcherry or 150-600nl of AAV2-hSyn-DIO-mCherry (3×1012 vg/ml, 5.1×1012 vg/ml and 5.6×1012 vg/ml, respectively; Addgene and UNC Vector Core) into the MeA of Foxp2cre+/- mice ...
-
bioRxiv - Neuroscience 2022Quote: miR-30a-chimeric hairpins for miR-329 and miR-495 stable overexpression were generated via polynucleotide cloning into the 3’ UTR of eGFP in pAAV-hSyn-EGFP vector (Addgene Plasmid #114213) using BsrGI and HindIII sites ...
-
bioRxiv - Developmental Biology 2022Quote: ... HEK293T cells at 70-80% confluency in 10 cm dishes were transfected with the insert construct plus 3rd generation packaging plasmids: pMD2.G (3 μg, Addgene plasmid #12259), psPAX2 (6 μg ...
-
bioRxiv - Cell Biology 2024Quote: ... was either mutagenized in a 3 kb cloning plasmid (pKSPS (Bahri et al., 2021)) before subcloning into pQCXIB (the retroviral expression vector, Addgene plasmid #22800) or was directly mutagenized in pQCXIB ...
-
bioRxiv - Developmental Biology 2023Quote: ... were transfected with 3 μg targeting vector pUC19-OCT4-T2A-NLS-EmGFP-P2A-Puro (kind gift from Timo Otonkoski; Addgene plasmid #89992) and 3 μg of PX459 plasmid (kind gift from Feng Zhang ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5’ and 3’ fragments containing incorporated mutated gene ORF sequences were amplified by PCR from the pDONR223-TP53 WT plasmid (Addgene; Plasmid #82754). In this case ...
-
bioRxiv - Cancer Biology 2023Quote: ... and non-targeting sgRNA controls (SCR; supplementary table 3) flanked with BsmBI overhangs were ligated into the vector FgH1tUTG-GFP (Addgene Plasmid #70183) using 1uL BsmBI (New England Biolabs ...
-
bioRxiv - Synthetic Biology 2023Quote: ... we designed a construct for the first tier of the dCas9-based cascade that is expressed from the EF1α promoter and contains a SapI-flanked cloning site in the 3’UTR for adding a gRNA to target a downstream target: “EF1a-Triplex-28-M13-28-pA” (Addgene ID 202041). Detailed protocols for modifying all of these constructs are provided on the Addgene website.
-
bioRxiv - Molecular Biology 2024Quote: ... WTC-11 iPSCs were electroporated with the corresponding homology plasmid (3 µg per electroporation) and two TALEN plasmids (0.75 µg per electroporation each) targeting the AAVS1 locus (Addgene, #52341 and #52342). iPSCs were dissociated into a single cell suspension ...
-
bioRxiv - Biochemistry 2022Quote: pCS2+8 empty vector (e.g., Addgene #34931)
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... The empty pCS2+8 vector (Addgene #34931) was from Addgene ...
-
bioRxiv - Microbiology 2023Quote: ... and pBTK401 (Type 8) (Addgene_65109, Addgene_183127, Addgene_65179 ...
-
bioRxiv - Cell Biology 2024Quote: ... and the pAAV2/8 plasmid (Addgene # 112864) using polyethylenimine (1 µg/µl ...
-
bioRxiv - Microbiology 2019Quote: ... the pSLC recombineering series (11) which was a gift from Swaine Chen (Addgene plasmid # 73194), pON.mCherry (21 ...
-
bioRxiv - Neuroscience 2022Quote: ... 250μl per site at an 11-degree angle) with AAV5-EF1α-DIO-ChR2-eYFP (Addgene) to selectively target neuronal populations expressing Cre ...