Labshake search
Citations for Addgene :
2351 - 2400 of 3780 citations for 6 9 Ethano 4H imidazo 4 5 d pyridazino 1 2 a pyridazin 4 one 2 butyl 3 6 7 8 9 11 hexahydro 6 9 dimethyl 3 2' 2H tetrazol 5 yl 1 1' biphenyl 4 yl methyl since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... with lentiviral packaging vectors psPAX2 (7 μg; Addgene) and pMD2.G (3,5 μg ...
-
bioRxiv - Neuroscience 2021Quote: ... 7 μg Cas9 nuclease plasmid (pX459, Addgene #62988) 1.4 μg pPN298 and 1.4 μg pPN306 were electroporated into 2.5×106 cells at 1050V ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV2/7 (gifted from James M. Wilson [Addgene plasmid # 112863 ...
-
bioRxiv - Neuroscience 2024Quote: ... pGP-AAVrg-hSyn-mCherry (7× 1012GC/ml; Addgene) was infused into the NAc (A/P ...
-
bioRxiv - Cell Biology 2022Quote: ... A Rac1 specific gRNA 5’ ACACTTGATGGCCTGCATCA was cloned into plasmid pX330-BbsI-PITCh (Addgene plasmid #127875) and transfected along with pN-PITCh-GFP-Rac1 into HeLa cells using JetPrime (Polyplus ...
-
bioRxiv - Cell Biology 2021Quote: ... cDNA encoding TNKS ARC1-5 (aa 174-985) was subcloned by PCR into pFLAG-CMV2 (Addgene.org). All vectors subcloned using PCR were sequenced on both strands for verification.
-
bioRxiv - Cell Biology 2021Quote: ... antisense: 5’-aaacTACGCATTGGACGGCTCCTCc) was cloned into pSpCas9 (BB)-2A-mCherry created by PX459 V2.0 (Addgene #62988). This plasmid was then transfected into immortalized STING-knockout MEFs (Mukai et al. ...
-
bioRxiv - Cancer Biology 2022Quote: ... SKOR1-shRes-WT and -Y234F were then recombined into pLenti CMV-GFP (658-5) (Addgene; 17448). For transduction of the above mentioned constructs ...
-
bioRxiv - Neuroscience 2022Quote: ... [14] and low-titer Cre (AAV9-hSyn-Cre-WPRE-hGH; Addgene #105553, MOI = 5×103 vg) AAVs on DIV 7 ...
-
bioRxiv - Cancer Biology 2019Quote: ... HCT116-Dnmt1Δ3-5 cells were transfected with pcDNA3 vector containing WT full length DNMT1 (36939, AddGene) and empty pcDNA3 vector as a transfection control (10792 ...
-
bioRxiv - Cell Biology 2020Quote: ... Blunt-end repaired RhoBAST16 was cloned into 5′ UTR CGG 99× FMR1-EGFP (Addgene, plasmid #63091) which was digested with the NotI enzyme ...
-
bioRxiv - Molecular Biology 2021Quote: ... an XhoI restriction site was generated 5’ of the GFP-gene in pDRGFP (Addgene plasmid #26475)23 and the GFP-gene was replaced by the eBFP1.2 gene using the XhoI/NotI restriction sites ...
-
bioRxiv - Physiology 2022Quote: ... The control virus AAV2/5-hSyn-DIOmCherry was ordered from Penn Vector Core (Addgene plasmid 50459). Animals were allowed to recover from stereotaxic surgery for a minimum of 21 days before initiation of any experiments ...
-
bioRxiv - Neuroscience 2023Quote: ... neurons were transduced with AAV9-Syn (5 x 109 gc per well) encoding jGCaMP8s (AddGene 162374) or CaBLAM (in house prep) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and guide cassettes were assembled into pGGG-M along with end linker pELE-5 (Addgene #48020). The resulting plasmid was named pGGG-TaDMC1-D and sequenced to ensure authenticity before transferring to Agrobacterium.
-
bioRxiv - Molecular Biology 2023Quote: ... Three clones with the correct insertion were transiently transfected with either 5 μg pFlpO (Addgene #13793) to remove the neomycin selection cassette or both 5 μg pFlpO (Addgene #13792 ...
-
bioRxiv - Neuroscience 2023Quote: ... or eYFP alone as a control (AAV-EF1a-DIO-eYFP; serotype 5; Dr. Karl Deisseroth; RRID:Addgene_27056).
-
bioRxiv - Cancer Biology 2023Quote: The sgRNAs specific for 5’ to the region of interest were cloned in pLentiCRISPRv2 (Addgene, #52961). sgRNAs corresponding to 3’ to the region of interest was cloned in pDecko-mCherry (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: ... in VTA of TH-Cre rats (N=5) or simultaneously expressing AAV9-rTH-PI-Cre (AddGene #107788 ...
-
bioRxiv - Neuroscience 2024Quote: ... The sgRNA target sequence: 5’-GCCGGCGAGCACTTTTATTG was cloned into the pU6-BbsI-chiRNA vector (Addgene, #45946). The vector for HDR contains the 5’ homology arm containing Shv genomic region (1000 base pairs at the 3’ end of the Shv gene with the stop codon removed ...
-
bioRxiv - Bioengineering 2024Quote: ... 10 μg of transfer plasmid was co-transfected with 5 μg of pMD2.G (Addgene, #12259) and 7.5 μg of psPAX2 (Addgene ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cargo RNA expression plasmids for mCherry-MS2×8 and Cre-MS2×8 were pFH2.22 (Addgene, #205537) and pJAM1.52 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The p-EGFP plasmid (#6077-1) was purchased from Addgene (Watertown, MA); the pEGFP-TSC2 plasmid was created as previously described in (52 ...
-
bioRxiv - Neuroscience 2022Quote: ... pAAV-mDlx-GFP-Fishell-1 (gift from Gordon Fishell; Addgene plasmid # 83900) was used to cut out Dlx enhancer and HBB promoter with MluI and EheI (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... MKL-1 Cas9 cell line was developed using pCWCas9 Blast (Addgene #83481) with Blasticidin (10ug/mL ...
-
bioRxiv - Cell Biology 2022Quote: ... HIV-1-GAG fused with EGFP was purchased from Addgene (plasmid 80605). Ezrin plasmid was a generous gift of Adam Kwiatkowski (University of Pittsburgh School of Medicine ...
-
bioRxiv - Neuroscience 2020Quote: ... and pCS2-FLAG-UBQLN1 plasmid (p4458 FLAG-hPLIC-1; Addgene plasmid # 8663) were gifts from Peter Howley (42) ...
-
bioRxiv - Neuroscience 2021Quote: ... and pCS2-FLAG-UBQLN1 plasmid (p4458 FLAG-hPLIC-1; Addgene plasmid # 8663) were gifts from Dr ...
-
bioRxiv - Cancer Biology 2020Quote: ... human PML SUMO-1 mutant and GFP-BLM were purchased from Addgene (#62804 ...
-
bioRxiv - Biochemistry 2021Quote: ... TRCN0000047920) and cloned into the lentiviral pLKO.1 vector (Addgene, Watertown, MA) as previously described 56 ...
-
bioRxiv - Neuroscience 2020Quote: ... Sham animals included virgins injected with halorhodopsin (AAV1.CaMKIIa.eNpHR.EYFP; Addgene; N=1) that received no optical stimulation ...
-
bioRxiv - Cell Biology 2021Quote: ... pLVX-GFP-Centrin-1 was a gift from Manuel Thery (Addgene #73331).
-
bioRxiv - Cancer Biology 2020Quote: pLKO.1-shmSlug4 was a gift from Bob Weinberg (Addgene plasmid # 40648), pPGS-hSLUG.fl.flag was a gift from Eric Fearon (Addgene plasmid # 25696) ...
-
bioRxiv - Cell Biology 2021Quote: ... pAAV-mDlx-GFP-Fishell-1 was kindly provided by Gordon Fishell (Addgene plasmid #83900 ...
-
bioRxiv - Cell Biology 2021Quote: ... but with a pLKO.1-based vector (gift from Elaine Fuchs, Addgene plasmid # 25999 ...
-
Activation of the Integrated Stress Response overcomes multidrug resistance in FBXW7-deficient cellsbioRxiv - Cancer Biology 2022Quote: ... DLD-1 cells were infected with pCLX-CHOP-dGFP lentiviruses (Addgene, 71299), single cell isolated ...
-
bioRxiv - Microbiology 2022Quote: ... The amplified TaPHB-1 was cloned into pcDNA3-RFP plasmid (#13032, Addgene) using HindIII and NotI restriction sites ...
-
bioRxiv - Biophysics 2022Quote: ... The transfer vector consisted of a modified pLKO.1 neo plasmid (Addgene) with expression of the shRNA sequences under control of 3× copies of the lac operator and a copy of the mNeonGreen fluorescence protein ...
-
bioRxiv - Biophysics 2022Quote: ... pGEMHE:mTREK-1(K271Q) was a gift from Dan Minor (Addgene plasmid # 133270) (Lolicato et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... Nontargeting shRNA in pLKO.1 (shSCR) was used as a control (Addgene). For sgRNA experiments ...
-
bioRxiv - Biochemistry 2021Quote: The FLAG-HSF-1 plasmid was purchased from Addgene (ID 32537, RRID:Addgene_32537), which was originally established by Dr Stuart Calderwood (40) ...
-
Serotonin Modulates an Inhibitory Input to the Central Amygdala from the Ventral Periaqueductal GraybioRxiv - Neuroscience 2022Quote: ... NC) or AAV9-hSyn-EGFP (diluted 1:10 in sterile PBS, Addgene) was injected bilaterally into the CeA of C57Bl/6J mice ...
-
bioRxiv - Molecular Biology 2020Quote: ... pLKO.1-Puro was a gift from Bob Weinberg (Addgene plasmid # 8453) (35) ...
-
bioRxiv - Pathology 2020Quote: ... the pLKO.1-puro empty vector was purchased from Addgene (Watertown, MA). A scrambled shRNA control and shRNAs specific for the mouse EZH1 and EZH2 genes were designed by RNAi Central (http://cancan.cshl.edu/RNAi_central/step2.cgi) ...
-
bioRxiv - Cell Biology 2020Quote: ... or GFP-K17ΔNLS cDNA (pEGFP-C3 vector backbone; Addgene REF# 6082-1) were transfected into cells using FuGENE HD Transfection Reagent (Promega REF# E2311 ...
-
bioRxiv - Cell Biology 2019Quote: ... pLKO.1 hygro was a gift from Bob Weinberg (Addgene plasmid # 24150). The maps and the full-length sequences of all the constructs generated in this study are provided in SI2.
-
bioRxiv - Neuroscience 2020Quote: ... or AAV9.hSyn Pr.DIO.hM4Di-mCherry (≥ 1×1013 vg/mL, Addgene # 44362-AAV9). For controls ...
-
bioRxiv - Cancer Biology 2020Quote: ... to 2μg pLKO.1 shRNA plasmid: 1500ng psPAX2 packaging plasmid (Addgene #12260): 500ng pMD2.G envelope plasmid (Addgene #12259 ...
-
bioRxiv - Microbiology 2020Quote: ... pcDNA3 HA eIF4GI (1–1599) was a gift from Nahum Sonenberg (Addgene plasmid #45640 ...
-
bioRxiv - Genomics 2021Quote: ... The Dlx promoter sequence was from pAAV-mDlx-GFP-Fishell-1 (Addgene plasmid #83900 ...