Labshake search
Citations for Addgene :
201 - 250 of 346 citations for 8 Benzylthio 6 oxo octanoic Acid Methyl Ester d4 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were plated in 6-well plate and co-transfected with SBE4-Luc plasmid (1 μg, Addgene,16495) and pDEST26-Renilla plasmid (0.1 μg ...
-
bioRxiv - Cell Biology 2023Quote: ... Two million iPSCs were electroporated with 6 µg of CAG-Cas9-T2A-EGFP-ires-Puro (deposited in Addgene, plasmid no ...
-
bioRxiv - Neuroscience 2023Quote: ... neonatal Swiss Webster or C57Bl/6 (P0–3) mice were anesthetized on ice for 3 min before injecting viral vectors (AAV5.GfaABC1D.GCaMP6f.SV40 [Addgene, 52925-AAV5] ...
-
bioRxiv - Genomics 2023Quote: ... All 3 of the 6 wells were transfected with 100 ng of pCAG-NLS-HA-Bxb1 (Addgene #51271) and 1,500 ng of donor attB library whereas the T25 was transfected with 1,000 ng of the Bxb1 containing plasmid and 5,000 ng attB library ...
-
bioRxiv - Developmental Biology 2023Quote: ... EGFP-Tubulin-6 was a gift from Michael Davidson (Addgene plasmid # 56450; http://n2t.net/addgene:56450; RRID: Addgene_56450). mTagBFP-Lysosomes-20 was a gift from Michael Davidson (Addgene plasmid # 55263 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells (2.5 x 105) were plated in a 6-well plate and transfected with pLenti-BLRR (Addgene # 158958), pLenti-trGluc (Addgene # 158959) ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... mCherry-tagged hM3Dq excitatory DREADD (hSyn-DIO-hM3Dq-mCherry; titer: 6 x 1012 vg/ml; Addgene catalog #: 44361) was injected bilaterally into VTA (relative to bregma (mm) ...
-
bioRxiv - Neuroscience 2024Quote: ... 6 × 107 RPE1 cells were infected with the human sgRNA library (Human GeCKO v2 Library Cat#1000000048, Addgene) at an MOI of ∼0.3 ...
-
bioRxiv - Neuroscience 2024Quote: ... groups of 3-4 pups were separated from their mother and 6 µl of AAV9.CAG.GCaMP6s.WPRE.SV40 (Addgene, USA) was injected subcutaneously in the nape of the neck ...
-
bioRxiv - Genomics 2024Quote: ... 15 million HEK293T cells were transfected 15 million HEK293T cells were grown overnight on 15 cm poly-L-Lysine coated dishes and then transfected with 6 ug pMD2.G (Addgene plasmid # 12259; http://n2t.net/addgene:12259; RRID:Addgene_12259), 18 ug dR8.91 (since replaced by second generation compatible pCMV-dR8.2 ...
-
bioRxiv - Bioengineering 2024Quote: ... was amplified using primers 5 and 6 listed in Supplementary Table 1 from pEPkan-S (Addgene plasmid #41017; http://n2t.net/addgene:41017; RRID:Addgene_41017) 13 and inserted into the XhoI site of pBS-Puro2ABFP-WPRE using GeneArt Gibson Assembly EX Master Mix (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2021Quote: ... 8-12 weeks old Ucn3::Cre male mice were stereotaxically injected with pAAV-hSyn-DIO-hM3D(Gq)-mCherry (Addgene, Cambridge, MA) bilaterally into the PeFA (AP −0.6 ...
-
bioRxiv - Systems Biology 2020Quote: ... the cells were transfected with a mix of 8 μg lentiviral lentiCRISPRv2 vector containing the TKOv3 gRNA library 21 (Addgene #90294), 4.8 μg packaging vector psPAX2 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and to the cell suspension was also added 8 ug of donor plasmid (AICSDP-52: HIST1H2BJ-mEGFP is Addgene plasmid # 109121). Cells were then electroporated using a Gene Pulser Xcell electroporation system at 160 V for 30 ms ...
-
bioRxiv - Biophysics 2022Quote: ... a pQE-30/pcl-ts ind+ plasmid containing a His6-SUMO SARS-CoV-2 nsp12 and untagged nsp7 & 8 (Addgene #160540) was transformed into E ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... L2 assembly: L1 modules and annealed oligonucleotides (8-9, Table S5) assembled into the L2 destination vector pAGM4723-Del (Addgene #112207). The final plasmids ...
-
bioRxiv - Neuroscience 2023Quote: We used AAV1-hSyn-GCaMP6f (2 × 1013 vg/mL Penn Vector Core/Addgene; diluted 1:8 to 1:15 in saline) for experiments involving two-photon calcium imaging of V1 layer 2/3 cells ...
-
bioRxiv - Cancer Biology 2023Quote: ... sgRNA vectors for each given condition (OE, KO, NT) were pooled and co-transfected with pAdH helper plasmid and pAAV2/8 capsid (Addgene, #112864) with polyethylenimine (PEI) ...
-
bioRxiv - Genetics 2024Quote: ... To determine MOI and approximation of appropriate viral volume we infected day 14 iGLUTs (0, 1, 2, 4, 8, 10, 16, 32, 64 µL) with control lentivirus (pLS-SV40-mP-EGFP; AddGene #137724) and harvested for 48hrs later ...
-
bioRxiv - Biochemistry 2024Quote: ... The DIvA cells were plated 24 h before experiments onto 8 well ibidi glass bottom dishes and transiently transfected with eGFP-53BP1 (Fradet-Turcotte A, 2013) (Addgene #60813) via use of Lipofectamine 3000 according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: sgRNA sequences targeting Atg7 (CACCGTCTCCTACTCCAATCCCGTG), Pcyt2, (CACCGCCATGATCCGGAACGGGCA) or a non-genic region on mouse chromosome 8 (Chr8, ACATTTCTTTCCCCACTGG) were cloned into lentiCRISPRv2 (Addgene, 52961). sgRNA sequences targeting Trp53 (GAAGTCACAGCACATGACGG ...
-
bioRxiv - Biochemistry 2021Quote: ... DNA encoding amino acids Ala696-Phe740 of human DDX1 was cloned into UC Berkeley MacroLab 438C (Addgene plasmid #55220). The resulting plasmid encoded for untagged RTCB(1-505) ...
-
bioRxiv - Neuroscience 2020Quote: 8 weeks old Mrap2fl/fl Mc4regfp females (n=4) were injected unilaterally with pAAV-Ef1a-mCherry-IRES-CRE (Addgene, catalog #55632-AAV8).
-
bioRxiv - Genetics 2020Quote: ... Male mice at ages 8-12 weeks were Jugular vein injected with 1011 particles of AAV expressing either Cre recombinase (Addgene 107787-AAV8) or GFP (Addgene 105535-AAV8 ...
-
bioRxiv - Biophysics 2023Quote: ... a pQE-30/pcl-ts ind+ plasmid containing a His6-small ubiquitin-like modifier (SUMO) SARS-CoV-2 nsp12 and untagged nsp7 and 8 (Addgene no. 160540) was transformed into Escherichia coli BL21 cells (Agilent) ...
-
bioRxiv - Cell Biology 2024Quote: ... Rab7a with a point mutation at residue 8 from leucine to alanine (L8A) was cloned into pEmerald-C1 (Addgene#54734, Davidson Lab) at XhoI-BamHI sites by Genscript ...
-
bioRxiv - Bioengineering 2024Quote: ... mRFP was amplified from pDEST-12.5’RFP 14 by PCR using primers 7 and 8 listed in Supplementary Table 1 and cloned into the NheI-KpnI site of pEGFP-C2 (Addgene, #6083-1) using the In-Fusion® HD Cloning Kit (Takara Bio USA) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The pAR-Ec611 (ArEc-Rev1-611) plasmid harboring medium-error-rate polymerase TP-DNAP1_611 (≥10−6 s.p.b.) was obtained from Addgene (Watertown, MA).
-
bioRxiv - Bioengineering 2020Quote: Plasmid pBAD-His-6-Sumo-TEV-LIC cloning vector (8S) was a gift from Scott Gradia (Addgene plasmid 37507). The plasmid was modified via restriction enzyme digestion (final construct ...
-
bioRxiv - Microbiology 2021Quote: ... 8 × 105 293 T cells in a 6 cm dish were cotransfected with 2 μg of HIV-1 packaging plasmid pCMVΔ8.2 R (Addgene # 12263); 0.5 μg of the pCMV-VSV-G plasmid (Addgene # 8454 ...
-
bioRxiv - Cell Biology 2020Quote: ... 1999)-with the codon optimized GAL80 sequence from pBPGAL80Uw-6-a gift from Gerald Rubin (Addgene plasmid #26236, http://n2t.net/addgene:26236; RRID:Addgene-26236) (Pfeiffer et al. ...
-
bioRxiv - Developmental Biology 2021Quote: ... Lee and Luo 1999)- with the codon optimized GAL80 sequence from pBPGAL80Uw-6 - a gift from Gerald Rubin (Addgene plasmid #26236 ...
-
bioRxiv - Microbiology 2023Quote: 4e5 VeroE6 cells were plated in 6-well plates and transfected with 1 μg VSV-G plasmid (Addgene #8454) via TransIT-X2 (Mirus) ...
-
bioRxiv - Biochemistry 2024Quote: ... Cells were subcultured twice a week at a ratio of 1:5 to 1:8.Transient transfection of HeLa cells (1–2 x 105 cells/6-well) with pcDNA3.1(+) NAPstar or pSC2 HyPer7 (Addgene; plasmid #136466 ...
-
bioRxiv - Cell Biology 2023Quote: ... we cloned human OPTN cDNA in a pETDuet-1 vector with an N-terminal 6×His tag followed by a TEV cleavage site (RRID:Addgene_190191). After the transformation of the pETDuet-1 vector encoding 6×His-TEV-mCherry-OPTN in E ...
-
bioRxiv - Cell Biology 2023Quote: ... we cloned human NDP52 cDNA in a pETDuet-1 vector with an N-terminal 6×His tag followed by a TEV cleavage site (RRID:Addgene_187829). After the transformation of the pETDuet-1 vector encoding 6×His-TEV-mCherry-NDP52 in E ...
-
bioRxiv - Cell Biology 2023Quote: Cells in a 6-well plate (approximately 70% confluent) were transfected with 0.4ug of an Actin5C-EGFP plasmid (pAc5.1B-EGFP, Addgene #21181) using Effectene Transfection Reagent (Qiagen) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were transfected for 6 hours with 80 ng 3xERRE-ERE-luciferase containing codon-modified firefly luciferase (Addgene #37852) and 16 ng pRL-SV40P (Addgene #27163 ...
-
bioRxiv - Cell Biology 2024Quote: ... The sgRNA 5’-CGTTTTCAGAGTGATGGCGA-3’ targeting the efa-6 ATG was selected using CRISPR design tool (http://crispr.mit.edu) and was inserted into pDD162 vector (Addgene #47549) using primers YJ12362 and YJ12363 (Table S2/3 ...
-
bioRxiv - Molecular Biology 2024Quote: ... LOX-1 tagged with V5-6×His at the C-terminus (V5-LOX-1) was subcloned into pmScarlet_C1 (plasmid #85042; Addgene) (mScarlet-LOX-1) ...
-
bioRxiv - Bioengineering 2024Quote: ... D-REPRESS 1 to 6 plasmids were cloned following the same manner with dRfxCas13d amplification from pXR002 (Addgene #109050)24 ...
-
bioRxiv - Neuroscience 2022Quote: The pCMV-hEAAT2 plasmid encoding the human excitatory amino acid transporter type 2 (EAAT2) was a gift from Susan Amara (Addgene plasmid # 32814 ...
-
bioRxiv - Microbiology 2021Quote: pLenti.GFP.NLuc is a dual GFP/nanoluciferase lentiviral vector based on pLenti.CMV.GFP.puro that contains a GFP/nanoluciferase cassette separated by a picornavirus P2A self-processing amino acid motif cloned into the BamH-I and Sal-I sites (Addgene plasmid #17448 ...
-
bioRxiv - Cell Biology 2020Quote: ... and FLAG-tagged FL human TSC2 (1807 amino acids, UniProtKB/Swiss-Prot accession number P49815- 1) were purchased from Addgene, and pRK7 was subcloned with FLAG-tagged human TBC1D7 (293 amino acids ...
-
bioRxiv - Biochemistry 2023Quote: The coding sequence for amino acids 1-110 of GCP2 were PCR amplified from pACEBac1-gamma-TuSC (a gift from Tarun Kapoor (Addgene plasmid # 178079 ...
-
bioRxiv - Cancer Biology 2024Quote: Truncated CPSF6 containing amino acids 1-358 (CPSF6-358) from human isoform 1 was cloned into the pCW57.1 backbone (Addgene 71782). A hemagglutinin (HA ...
-
bioRxiv - Neuroscience 2021Quote: stGtACR2: 300 nL 1:10 AAV2/8-hSyn1-SIO-stGtACR2-FusionRed (working concentration 4.7*1011 gc/mL, Addgene/Janelia Viral Core, Ashburn, VA)
-
bioRxiv - Synthetic Biology 2023Quote: ... was cloned by generating PCR fragments from the pTetQCas-8+IS186 and the pTnsABC construct (gift from Sheng Yang (Addgene plasmid # 170636; & #1306331)) using the GeneArt™ Gibson Assembly HiFi Master Mix (InvitrogenTM) ...
-
bioRxiv - Cancer Biology 2020Quote: ... to co-transfect pBABE-puro or pBABE-puro.SLX4IP.3xFLAG with pCMV-VSV-G (at a ratio of 6:1, Addgene#8454) into GP2-293 cells (Clontech) ...
-
bioRxiv - Molecular Biology 2022Quote: ... in 6-well plates (1.5×106 cells/well) and co-transfected with the cAMP sensor Pink Flamindo (Addgene plasmid #102356) and either empty vector or the given GPR126 construct in the pULTRA vector on the next day using Lipofectamine 2000 according to the manufacturer’s protocol ...