Labshake search
Citations for Addgene :
151 - 200 of 346 citations for 8 Benzylthio 6 oxo octanoic Acid Methyl Ester d4 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... The original CIRTs-6: B-defensin 3-TBP6.7-YTHDF2 plasmid (# 132544) was purchased from Addgene and the YTHDF2 domain was PCR amplified and cloned into the AgeI and NheI sites ...
-
bioRxiv - Neuroscience 2022Quote: [6] 15xQUAS from BAC-ECFP-15xQUAS_TATA-SV40 (a gift from Christopher Potter, Addgene ID #104875) (Riabinina et al. ...
-
bioRxiv - Microbiology 2022Quote: ... 500 ml LB culture of pCDFDuet-1-6×His-SARS-CoV-2-NSP7/NSP8 (Addgene)-transformed E.coli BL21 DE3 strain was induced by isopropyl β-d-1-thiogalactopyranoside (IPTG ...
-
bioRxiv - Neuroscience 2024Quote: ... 6-week-old Slc17a7Cre mice were injected with pAAV-EF1a-DIO-tdTomato-WPRE virus (RRID:Addgene_133786 ...
-
bioRxiv - Neuroscience 2021Quote: ... 2016) (Fig. 5A, Suppl. Figs. 3C,D and 8; Salk Vector Core; 1.0 x 1012; Addgene plasmid #55636); AAV1-SynP-DIO-splitTVA-EGFP-B19G (Fig ...
-
bioRxiv - Cell Biology 2023Quote: ... were transfected with a complex of 4µg of pAAV2/8 (a gift from James M. Wilson, Addgene #112864), 4µg of pHelper (Takara Bio) ...
-
bioRxiv - Biophysics 2024Quote: ... which was a gift from Joost Snijder (Addgene plasmid #175359; #175358 http://n2t.net/addgene:175359; RRID:Addgene_175359 or 8) were used to create the scFv region ...
-
bioRxiv - Synthetic Biology 2021Quote: Plasmids used in this work are listed in Supplementary Table 6 and are available from Addgene (identifiers listed in Supplementary Table 6).
-
bioRxiv - Cancer Biology 2021Quote: ... A doxycycline-inducible Cas9 clonal cell line of NALM-6 (using plasmid pCW-Cas9, Addgene #50661) was generated ...
-
bioRxiv - Cell Biology 2020Quote: ... 6 µg psPAX2 and 3.6 µg pMD2G (gift from the Trono lab, Addgene #12259 and #12260) packaging plasmid using CalPhos Mammalian Transfection Kit (Takara) ...
-
bioRxiv - Neuroscience 2022Quote: ... Mice were injected with ∼2000 nl of a 1:6 ratio of AAV1-Syn-Cre (AAV.hSyn.Cre.WPRE.hGH, 105553-AAV1, Addgene) and AAV1-CAG-tdTomato (59462-AAV1 ...
-
bioRxiv - Neuroscience 2022Quote: ... Ir21a-Gal80 was created by subcloning the Ir21a promoter region into pBPGAL80Uw-6 (Addgene plasmid # 26236) [28 ...
-
bioRxiv - Neuroscience 2021Quote: ... Pups were injected bilaterally with 2 μl of AAV9-hsyn-ACh3.0 (1.8×10^13 gc/ml) and 2 μl of AAV9-hsyn-NES-jRCaMP1b (2.5×10^13 gc/ml, Addgene) per hemisphere ...
-
bioRxiv - Neuroscience 2020Quote: ... Chronos was manufactured at the University of Pennsylvania Vector Core (AAV2/8.Syn.Chronos.tdTomato, Addgene 62726, 1.6×1013 GC/ml). oChIEF was manufactured by Virovek (AAV2/1.CAG.flex.oChIEF.tdTomato ...
-
bioRxiv - Immunology 2021Quote: ... and a separate master mix was prepared comprising 1 mL Opti-MEM 8 µg PSPAX (12260, Addgene, Watertown, MA), 2 µg PMD2G plasmids (12259 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Optimal magnesium concentration was determined to be 8 mM based on expression of the plasmid pJL1-sfGFP (Addgene #69496) encoding superfolder Green Fluorescent Protein (sfGFP).
-
bioRxiv - Neuroscience 2024Quote: ... 8 rats were bilaterally injected with DREADDs virus AAV5-CaMKIIα-hM4Di-mCherry (titer, 2.3×1013; Addgene http://addgene.org/50477) and 8 rats were bilaterally injected with AAV5-CaMKIIα-mCherry control virus (titer ...
-
bioRxiv - Neuroscience 2024Quote: ... and 8 rats were bilaterally injected with AAV5-CaMKIIα-mCherry control virus (titer, 2.3×1013; Addgene http://addgene.org/114469).
-
bioRxiv - Neuroscience 2022Quote: ... 0.8 uL of a 1:1 mixture of EGFP (AAV9- Hsyn-DIO-EGFP;4.6*10^13 GC/mL; Addgene) and AAV8-GAD1-cre was injected unilaterally into VP ...
-
bioRxiv - Developmental Biology 2021Quote: ... a FoxO1 plasmid encoding a deleted DNA binding domain (amino acid 208-220) was used (Addgene #10694). After 24 hours ...
-
bioRxiv - Cell Biology 2022Quote: ... Viral transductions were done on day 6 with 5 μL of AAV1-CaMKII-GLuc-ASARTDL (Addgene 149503) or AAV1-CaMKII-GLuc-Untagged (Addgene 149502 ...
-
bioRxiv - Neuroscience 2020Quote: ... This product was subcloned into pBPLexa:P65UW (Addgene plasmid # 26231, 63 or pBPGal80uw-6 (Addgene plasmid # 26236, 63), which were gifts from Gerry Rubin ...
-
bioRxiv - Neuroscience 2020Quote: ... In one C57BL/6 animal each we used AAV5-Syn-GCaMP6s or AAVrg-Syn-jGCaMP7f (Addgene, USA) with similar results to those obtained with GCaMP6f (Supplementary Fig ...
-
bioRxiv - Molecular Biology 2023Quote: U2OS 2-6-3 D28N were generated by electroporation of pCMV_BE4max (Addgene #112093; Koblan et al., 2018) and phU6-gRNA expression cassette encoding the guide sequence AAGCGTCAGTCTGCCCTCCA (Addgene #53188 ...
-
bioRxiv - Microbiology 2024Quote: ... Guide RNAs targeting exon 6 of Akr1c13 were cloned into pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene #42230). A T7-sgRNA PCR product was amplified and in vitro transcribed as previously described (65 ...
-
bioRxiv - Cancer Biology 2023Quote: ... RB1 and TP53 sgRNA sequences highlighted in Supplementary Table 6 were cloned in a LentiCRISPRv2 (Addgene # 52961) backbone (47) ...
-
bioRxiv - Neuroscience 2024Quote: ... oligonucleotide pairs (Sup. Table 6) were annealed and cloned into BbsI-digested pCFD3-dU6-3gRNA (Addgene #49410), as previously described84 ...
-
bioRxiv - Neuroscience 2024Quote: ... and cloned it into pAAV/L7-6-GFP-WPRE (a gift from Hirokazu Hirai, Addgene plasmid # 126462); for AAV-S5E6 and AAV-HGT017 ...
-
bioRxiv - Genetics 2022Quote: ... The plasmid encoding the sgRNA n°8 used in this study is available on Addgene (BPK1520-sgRNA GLB1, Addgene #184378).
-
bioRxiv - Pathology 2021Quote: ... of adeno-associated virus serotype 8 encoding Cre recombinase under the hepatocyte-specific thyroid binding globulin promoter (AAV8-TBG-Cre) (Addgene) followed by a 12 days (12d ...
-
bioRxiv - Systems Biology 2023Quote: ... Lentiviruses were packaged according to the following protocol: Shuttle plasmid (8 μg), psPAX2 packaging vector (2 μg, a gift from Didier Trono (Addgene plasmid #12260 ...
-
bioRxiv - Biochemistry 2023Quote: ... 8 µg psPAX2 packaging plasmid DNA and 1 µg pMD2.G envelope plasmid DNA (both gifts from Didier Trono, Addgene plasmid no ...
-
bioRxiv - Neuroscience 2023Quote: ... DAT-Cre+/- / SERT-Flp+/- mice were injected with 500 nL of either AAV-DJ-ef1a-DIO-ChR2-eYFP or AAV-DJ-ef1a-DIO-eYFP bilaterally into the VTA and 1000 nL of AAV-8-nEF-CoffFon-NpHR3.3-eYFP (Addgene #137154) or AAV-DJ-ef1a-fDIO-eYFP into the DR and implanted bilaterally with optical fibers in the NAc medSh ...
-
bioRxiv - Biochemistry 2024Quote: ... AriB or AriA-AriB were cloned into an arabi-nose-inducible UC Macrolab vector 8-B (Addgene #37502; ampicillin-resistant) and Ocr was cloned into an IPTG-inducible pTrc99A-based vector (kanamycin-resistant) ...
-
bioRxiv - Neuroscience 2023Quote: AAV serotype 8 viral vectors encoding for floxed EGFP under the synapsin promoter (pAAV-hSyn-DIO-EGFP (#50457)) were purchased from Addgene. rAAV-PV-EGFP-bGH polyA and rAAV-PV-CRE-EGFP-bGH polyA encoding for EGFP under the PV promoter were purchased from BrainVTA ...
-
bioRxiv - Cell Biology 2022Quote: ... The sgRNA expression vectors were generated by cloning appropriate DNA oligonucleotides (Suppl. Table 8) in the BbsI restriction sites of pX459 (#62988, Addgene). In brief ...
-
bioRxiv - Neuroscience 2024Quote: ... Each eye was intravitreally injected with 1 μL of AAV2-hSyn-DIO-mCherry (∼8 x 1012 GC/mL, cat. #: 50459-AAV2, Addgene) using a custom Hamilton syringe (Borghuis Instruments ...
-
bioRxiv - Neuroscience 2024Quote: ... Each eye was intravitreally injected with 1 μL of AAV2-hSyn-DIO-hM3Gq-mCherry (∼8 x 1011 GC/mL, Addgene) using a custom Hamilton syringe (Borghuis Instruments ...
-
bioRxiv - Neuroscience 2024Quote: ... and then bilaterally injected with 150 nl of rgAAV-hSyn-DIO-hM3Gq-mCherry (∼8 x 1012 GC/mL, cat. #: 44361-AAVrg, Addgene) in the suprachiasmatic nucleus (SCN ...
-
bioRxiv - Biochemistry 2024Quote: ... The transfection mix was composed of 8 ng of pC0037 reporter plasmid (a gift from Feng Zhang, Addgene plasmid #181934), 96 ng of plasmid for corresponding Cas 13 protein ...
-
bioRxiv - Cancer Biology 2024Quote: 786-O and HKC-8 cells were transfected with 2.5µg of pcDNA3.1-HA (Addgene plasmid #128034; gift from Oskar Laur) and HA-EPAS1/HIF2A-pcDNA3 (Addgene plasmid #18950 ...
-
bioRxiv - Biophysics 2021Quote: ... we used the retinoic acid-responsive firefly luciferase expression vector pGL3-RARE-luciferase (Addgene plasmid #13458; http://n2t.net/ad-dgene:13458; RRID:Addgene_13458), a gift from T ...
-
bioRxiv - Neuroscience 2021Quote: ... 6-7E6 cells were resuspended in nucleofection solution and mixed with 3ug of pCAG-EGFP plasmid (Addgene, 89684) and 600nM of siRNA ...
-
bioRxiv - Biochemistry 2020Quote: The original coding sequence for H2B:GFP was taken from pCS2-H2B:GFP plasmid (Addgene, Plasmid #53744, Supplementary Fig. 6), manually codon-optimized to minimize the occurrence of poly-Cn stretches (n<3) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The two sgRNAs targeting Dazl exon 6 were cloned into the pSpCas9(BB)-2A-GFP backbone (Addgene #48138). The knock-in led to the generation of a reporter cell line named Dazl-mScarlet-HygromycinR (DASH) ...
-
bioRxiv - Cell Biology 2020Quote: ... and ESRG (6 μg each) along with 3 μg of pMD2.G (gift from Dr. D. Trono; RRID:Addgene_12259) was transfected into PLAT-GP packaging cells ...
-
bioRxiv - Molecular Biology 2022Quote: ... Two million iPSCs were electroporated with 6 μg of CAG- Cas9-T2A-EGFP-ires-Puro (deposited in Addgene, plasmid no ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV5-CMV-EGFP (Suppl. Figs. 1A, 6 and 7D; Salk Vector Core; 2.08 x 1012; Addgene plasmid #32395); AAV9-FLEX-rev-ChR2-tdTomato (Suppl ...
-
bioRxiv - Neuroscience 2020Quote: The DNA fragment of H2B-mEos4b-6 (a gift from Michael Davidson (Addgene plasmid # 57508; http://n2t.net/addgene:57508; RRID:Addgene_57508)) and TRE (pTRE-tight vector (Clontech #631059) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Lee and Luo 1999)- with the codon optimized GAL80 sequence from pBPGAL80Uw-6 - a gift from Gerald Rubin (Addgene plasmid #26236, http://n2t.net/addgene:26236; RRID:Addgene_26236) (Pfeiffer et al ...