Labshake search
Citations for Addgene :
201 - 250 of 752 citations for 7α 12α Dihydroxy 5β cholestan 3 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... mEmerald-ER-3 was a gift from Michael Davidson (Addgene plasmid # 54082 ...
-
bioRxiv - Genomics 2021Quote: ... 10 µg D8.9 and 3 µg pCMV-VSV-G (Addgene) packaging plasmids using Lipofectamine LTX with Plus Reagent (Thermo Fisher) ...
-
bioRxiv - Cell Biology 2021Quote: GFP-tagged galectin 3 (pEGFP-hGal3 (Addgene, plasmid no. 73080) was mutated using the Q5 site directed mutagenesis kit (New England Biolabs ...
-
bioRxiv - Neuroscience 2022Quote: ... and (3) mKok amplified from pCS2+ ChMermaid S188 (Addgene 53617) with the CAAX membrane tag sequence (Sutcliffe et al. ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 3 µg MSCV CreERT2 puro (Addgene, 2276 ref (18)) and polybrene (8 µg/mL ...
-
bioRxiv - Biochemistry 2020Quote: pHA#852: mec-4p∷FynY531F∷unc-54 3’UTR (Addgene ID ...
-
bioRxiv - Neuroscience 2021Quote: ... The 1208 bp rab-3 promoter sequence (Addgene Plasmid #110880) was inserted directly upstream of the N-terminal TOMM-20 coding region ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 3 μg pMD2.G (gift from Didier Trono, Addgene #12259), 12 μg of pCMV delta R8.2 (gift from Didier Trono ...
-
bioRxiv - Microbiology 2022Quote: ... were generated by annealing two primers ordered from IDT DNA and cloned using BbsI into pKSB-sgRNA (Addgene #173671—3) vectors containing the U6 snRNA polymerase III promoter (AGAP013557) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and TGFBR2 (5’-ccttgtagacctcggcgaag-3’) cloned into LentiCRISPRv2 puro (Addgene) (20) ...
-
bioRxiv - Cancer Biology 2023Quote: Toronto Knockout Version 3 library was purchased from Addgene (#90294) (26) ...
-
bioRxiv - Neuroscience 2023Quote: ... Suppl Fig 3: AAV9-CaMKIIa-hChR2-EYFP (1:5, Addgene viral prep #26969- AAV9 ...
-
MYB68 orchestrates cork differentiation by regulating stem cell proliferation and suberin depositionbioRxiv - Plant Biology 2024Quote: ... and 3) the P336-FBP_11 vector (Available from AddGene (#139702)) ...
-
bioRxiv - Cell Biology 2022Quote: ... GGAACAAGTTCAGTGAACTG, #3: TGCATGCTCACTGATAATGA), IFIH1 (#1: CTTGGACATAACAGCAACAT, #2: TGAGTTCCAAAATCTGACAT) or TLR3 (#1: ACGACTGATGCTCCGAAGGG, #2: ACTTACCTTCTGCTTGACAA, #3: GGAAATAAATGGGACCACCA) and control gRNAs (Addgene plasmid #51763, #51762 and #51760) were ligated into pLentiCRISPRv2 (Addgene plasmid # 52961 ...
-
bioRxiv - Cell Biology 2021Quote: ... or into ‘All-in-one-GFP’ plasmid (AIO-GFP, gift from Steve Jackson (Addgene plasmid # 74119 http://n2t.net/addgene:74119; RRID: Addgene_74119))69 ...
-
bioRxiv - Cell Biology 2021Quote: ... Each guide RNA pair was cloned into either the ‘All-in-one-mCherry’ plasmid (AIO-mCherry, gift from Steve Jackson (Addgene plasmid # 74120; http://n2t.net/addgene:74120; RRID: Addgene_74120)) or into ‘All-in-one-GFP’ plasmid (AIO-GFP ...
-
bioRxiv - Neuroscience 2022Quote: ... anesthetized GAD1:Cre rats and wildtype littermates were injected with one of three AAV2 viral constructs obtained from Addgene: hSyn-DIO-hM4D(Gi)-mCherry ...
-
bioRxiv - Cancer Biology 2022Quote: ... and DNMT3B shRNAs were cloned into Tet-ON all- in-one plasmids LT3GEPIR (gift from Johannes Zuber, Addgene Plasmid #111177, RRID:Addgene_111177) and LT3REPIR (same as LT3GEPIR except for GFP being substituted with dsRed ...
-
bioRxiv - Cancer Biology 2019Quote: ... RDES and TC-32 were transduced with lentiviral pLKO-TET-ON all-in-one vector system (Plasmid #21915, Addgene) containing a puromycin resistance cassette ...
-
bioRxiv - Cancer Biology 2022Quote: ... sgRNA constructs for ANKLE1 knockout were generated by inserting oligonucleotides containing the targeted sequences (5′-TTCAGGGCACAGCCTAGAAC -3′ and 5′-GATTCT-GCCCTAGCCCCACC -3′) into the pX458 vector (Addgene Plasmid #48138 (Ran et al. 2013)) ...
-
bioRxiv - Cell Biology 2020Quote: ... we generated derivatives of pCFD5:U6:3-t::gRNA (Addgene, #73914). A first derivative (pCFD5:U6:3-t::gRNA_pst-1 ...
-
bioRxiv - Genetics 2021Quote: Calu-3 cells were transduced with lenti Cas9-Blast (Addgene #52962), or with lenti dCAS-VP64_Blast (Addgene #61425) ...
-
bioRxiv - Neuroscience 2022Quote: ... a 3:1 mixture of AAV-CAG-Flex-oG (Addgene #74292) and ΔG-Rab-GFP was injected into either the GS or TA muscles of P1-P2 pups ...
-
bioRxiv - Cancer Biology 2021Quote: pcDNA3.1-Myoferlin-HA and peGFP-hGalectin-3 was purchased from Addgene (plasmid no ...
-
bioRxiv - Neuroscience 2023Quote: ... and pC-(lox2-attB2-SA-T2A-Gal4-Hsp70)3 (Addgene #62957) were gifts from Benjamin H ...
-
bioRxiv - Genetics 2023Quote: ... pCFD4-U6:1_U6:3 was a gift from Simon Bullock (Addgene plasmid #49411 ...
-
bioRxiv - Plant Biology 2023Quote: ... a C-terminal 3×FLAG® epitope tag (pICSL50007; Addgene #50308), and 3′ UTR and terminator sequences from Agrobacterium tumefaciens nopaline synthase (AtuNOST ...
-
bioRxiv - Microbiology 2023Quote: ... pCfB2904(XI-3 MarkerFree) was a gift from Irina Borodina (Addgene plasmid # 73276 ...
-
bioRxiv - Biochemistry 2023Quote: The plasmid used to express Cas1 and Cas2/3 (Addgene #89240) was PCR amplified with mutagenic primer pairs using Q5 polymerase (NEB ...
-
bioRxiv - Neuroscience 2023Quote: ... we injected 3×100 nl AAV5.Ef1a.DIO.eYFP (Penn Core, Addgene: 27056) into the mPFC (AP/ML/DV coordinates 2.2 ...
-
bioRxiv - Cell Biology 2021Quote: ... Each guide RNA pair was cloned into either the ‘All-in-one-mCherry’ plasmid (AIO-mCherry, gift from Steve Jackson (Addgene plasmid # 74120 ...
-
bioRxiv - Molecular Biology 2021Quote: ... gIL6 was cloned into the all-in-one plasmid hU6-DR_BsmBI-EFS-RfxCas13d-NLS-2A-Puro-WPRE (Addgene #138147, ref18). DsRed plasmid was modified from pLenti-DsRed_IRES_EGFP (Addgene #92194 ...
-
bioRxiv - Systems Biology 2021Quote: ... HEK293FT cells were transfected with one of the three destination vectors plus a lentiviral packaging vector (psPAX2, Addgene plasmid #12260) and a VSV-G envelope expressing vector (pMD2.G ...
-
bioRxiv - Microbiology 2021Quote: The SpCas9 and guide RNA (gRNA) CRISPR components were both expressed from the one-vector lentiviral system “lentiCRISPR_v2” {25075903} (Addgene #52961). gRNA sequences for target genes were designed by submitting the sequence of an early exon (common to all isoforms ...
-
bioRxiv - Genomics 2021Quote: ... one set of cells received a lentivirus expressing the Cre recombinase under the control of the hSyn1 promoter (Addgene 86641). This induced expression of the dCas9p300 transgene in the neurons ...
-
bioRxiv - Bioengineering 2022Quote: ... we generated one plasmid harboring 4 distinct sgRNAs targeting the promoter region of AaRel1 (AAEL007696, OA-1127B, Addgene plasmid #190997). Firstly ...
-
bioRxiv - Bioengineering 2023Quote: ... Each well was transfected with 7.5 μg of one sgRNA plasmid of interest and 7.5 μg of a SpCas9 encoding plasmid (AddGene plasmid# 48137) through the calcium phosphate precipitation method as previously described (31) ...
-
bioRxiv - Genetics 2023Quote: ... in an all-in-one tetracycline- inducible expression cassette with AAVS1 homology arms (AAVS1-TRE3G-EGFP was a gift from Su-Chun Zhang (Addgene plasmid # 52343 ...
-
bioRxiv - Cancer Biology 2023Quote: ... which were designed by the Zhang lab to specifically target APOBEC3B53 were first subcloned into the all-in-one lentiCRISPR v2 plasmid (Addgene plasmid # 52961- a gift from Feng Zhang)53 ...
-
bioRxiv - Immunology 2024Quote: ... One microliter of 1:100 diluted product was used for golden gate cloning into lentiCRISPR v2-Puro (Addgene plasmid #52961) using 11 cycles of 5 minutes T4 ligase ligation at 16 °C and 5 minutes of BsmbI digestion at 37 °C ...
-
bioRxiv - Biochemistry 2024Quote: ... Step one assembly reactions were set up to obtain the vectors pACEBac1-POMP-PAC1-PAC2-PAC3-PAC4 (Addgene plasmid #XXXX), pACEBac1-PSMA1-PSMA2-PSMA3-PSMA4 ...
-
bioRxiv - Cell Biology 2020Quote: ... an sgRNA (5’-TTGGCACGCCTCCTCAGGCA-3’) was sub-cloned into PX458 (Addgene, 48138). The C-terminal region of the CENP-E gene was amplified with the following primers ...
-
bioRxiv - Developmental Biology 2021Quote: ... or exon 3 of TET3 and cloned into pX330 vector (Addgene #42230) as previously described 47 ...
-
bioRxiv - Developmental Biology 2019Quote: ... 3 µg of the pX-EGFP-g1 expression plasmid (Addgene plasmid #107273)28 was transfected into 1.0 × 106 gene-targeted patient iPSCs ...
-
bioRxiv - Molecular Biology 2019Quote: ... and RPA 2 and 3 were cloned into 11A vectors (Addgene: 48294), followed by assembly of all RPA subunits into one vector by successive ligation independent cloning reactions ...
-
bioRxiv - Neuroscience 2021Quote: pAAV-CaMKIIa-eGFP (titer ≥ 3×1012 vg/mL, Addgene, catalog # 50469-AAV5) and pAAV5-CaMKII-hChR2(H134R)-eYFP-WPRE (titer ≥ 1×1013 vg/mL ...
-
bioRxiv - Neuroscience 2019Quote: ... which were inserted into pDD162 (Peft-3::Cas9 + Empty sgRNA; Addgene #47549), respectively ...
-
bioRxiv - Biochemistry 2021Quote: pCDEF3-hTIM-3 was a gift from Lawrence Kane (Addgene plasmid # 49212), and contained the natural variant L119 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 3 µg pBABE-neo largeT antigen cDNA (Addgene, 1780 ref (16))using lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Developmental Biology 2020Quote: ... The injection mix contained: 60 ng/µl Peft-3::Cas9 (Addgene #46168), 15 ng/µl repair template ...