Labshake search
Citations for Addgene :
151 - 200 of 752 citations for 7α 12α Dihydroxy 5β cholestan 3 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... Adapter sequences were added to the 5’ and 3’ sequences (5’prefix: TGGAAAGGACGAAACACCG, 3’suffix: GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGC) to allow cloning by Gibson assembly in the lentiCRISPRv2 vector (Addgene #52961). The oligos were synthetized as a pool by LC Sciences ...
-
bioRxiv - Cancer Biology 2021Quote: ... two separate NR2F1 guide RNAs (guide 2: 5’-GATCCGCAGGACGACGTGGC-3’ and guide 4: 5’-GGCTGCCGTAGCGCGACGTG-3’) were cloned into pLentiCRISPRv2 (Addgene #52961). A non-targeting (NT ...
-
bioRxiv - Molecular Biology 2021Quote: ... of plasmids expressing sgRNAs (5′- ATTGTGATATCCGATAGTGAT-3′ and 5′-GTTCTGTCAGTGTGAAGAGG-3′) and Cas9 followed by the 2A-Puromycin cassette (pX459, Addgene #62988). 24 h after transfection ...
-
bioRxiv - Cell Biology 2019Quote: ... the Bmal1 coding sequence was cloned from mouse embryonic cDNA (forward primer: 5’ GGCGAATTCGCGGACCAGAGAATGGAC 3’; reverse primer: 5’ GGGCTCGAGCTACAGCGGCCATGGCAA 3’) and subcloned into the pBABE retroviral expression vector (Addgene, 1764). Retroviral vectors were transfected into Phoenix packaging cells ...
-
bioRxiv - Cancer Biology 2022Quote: ... gRNA sequences targeting Apc (5-CAACTTCTGGTAATGGTC-3) or Trp53 (5-AATGAGGCCTTGGAACTCA-3) were cloned into the Px330 vector (Addgene plasmid #42230). Organoids were removed from Matrigel using Dispase II (Gibco) ...
-
bioRxiv - Cell Biology 2023Quote: ... the primers 5’-AAACCTGGACCCCACCCCCAGATC-3’ and 5’-CACCGATCTGGGGGTGGGGTCCAG-3’ were annealed and cloned in the px458-pSpCas9(BB)-2A-GFP (Addgene, #48138) using the BpiI restriction site to generate a guide RNA ...
-
bioRxiv - Synthetic Biology 2023Quote: ... was PCR amplified from genomic DNA using primers (5’ CAGGTCTCAATCCCGATGTAGAACGCGAG 3’) and (5’ CGGTCTCACATATTGTTTCCTTTCTTTATTCACCGG 3’) and was cloned immediately upstream of SpCas9 amplified from plasmid PX165 (Addgene #48137) (62 ...
-
bioRxiv - Genomics 2023Quote: ... Guide RNAs (FANCC: 5’-GCAAGAGATGGAGAAGTGTA-3’ and MSH2: 5’-GTGCCTTTCAACAACCGGTTG-3’) were cloned into pSpCas9(BB)-2A-GFP (PX458) vector (Addgene#48138). AHH-1 cells were transfected using Lipofectamine 2000 (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2023Quote: ... The guide RNA targeting sequence 5’- TGGTCGTGGATACGAGAAGA-3’ was inserted into the Peft-3>Cas9 + sgRNA plasmid pDD162 [12] (Addgene #47549) using a Q5 site-directed mutagenesis (New England Biolabs) ...
-
bioRxiv - Cancer Biology 2023Quote: ... or FAXDC2 sg RNAs (sg3 5’-TCTTGTTCTACTATTCACAC-3’, sg4-TGGGGAAAGATATCATGCAC-3’) were cloned into was cloned into FgH1tUTG or FgH1tUTCyan plasmid (Addgene #85551) plasmids respectively ...
-
bioRxiv - Immunology 2023Quote: ... The SIYx3-GFP insert was generated with the primers: 5’-GGTGTCGTGAGGATCCACCATGGTGTCTATTTACAGGTAC-3’ 5’-CGCCCTCGAGGAATTCTTACTTGTACAGCTCGTCCATGC-3’ and cloned into pLV-EF1a-IRES-Blast (Addgene #85133) linearized with BamHI and EcoRI restriction enzymes (NEB ...
-
bioRxiv - Cell Biology 2023Quote: ... mCherry-iLID was amplified using 5’-GGTAGTAGTGGTAGTAGTATGGTGAGCAAGGGCGA-3’ and 5’-TCGAAGCTTGAGCTCGAGATCTTTAAAAGTAATTTTCGTCGTTCGCT-3’.The fragments were inserted into a pEGFP-C1 vector (Addgene 46956) using the AgeI/BglII restriction sites.
-
bioRxiv - Immunology 2024Quote: HEK293T cells were transfected with 3 µg of pmirGLO plasmid containing the 3’UTR of Zc3h12a or Tnf (Addgene plasmid 207127) (7 ...
-
bioRxiv - Developmental Biology 2020Quote: ... a sgRNA targeting the 3’ end of Spen ORF (5’-GATTGTCATTGCCTCGGTG-3’) was cloned in the Cas9-PuroR pX459 vector (Addgene plasmid #62988). The donor template was made using a gblock from Integrated DNA Technologies coding for compatible 5’ and 3’ HA of 600 bp with a NheI and AscI restrictions sites in-between the 5’ and 3’ HA ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... for the Right Arm (5’-TACATCCCTAAGGCCTGATTACCCGAACACT-3’, 5’-TATACGCGTTGCCATGCTATTGGCTTC-3’) and cloned into pHD-DsRed-attp (Gratz et al., 2014; Addgene Plasmid # 51019) in two steps ...
-
bioRxiv - Cancer Biology 2019Quote: ... GDI2 (crGDI2-1 Fw 5’ GCCACCCGAGTCAATGGGGA 3’ and crGDI2-2 Fw 5’ CACTCTCTCCTCCGTACGTA 3’) into a lentiviral CAS9 expressing plasmid (Addgene Plasmid # 49535) using the BSMB1 restriction sites ...
-
bioRxiv - Cell Biology 2021Quote: ... human MCOLN1 was amplified by PCR with the following oligonucleotides with overhangs (underlined): 5’-GACACCGACTCTAGAATGGTGAGCAAGGGCGAGGAGC-3’ (forward) and 5’-AACTAGTCCGGATCCTCAATTCACCAGCAGCGAATGC-3’ (reverse) from Mucolipin1-pEGFP C3 (Addgene plasmid #62960) construct and subcloned into XbaI and BamHI restriction sites of pLenti-CMV-MCS-GFP-SV-puro (Addgene plasmid #73582 ...
-
bioRxiv - Cancer Biology 2020Quote: ... tag-containing MAP3K7 forward primer (5’-cagtGGGCCCaccATGTA CCCATACGATGTTCCAGATTACGCTAGCGGCCGCATGTCTACAGCCTCTGCCG-3’) and its reverse primer (5’-ATAggatccTCATGAAGTGCCTTGTCGTTTC-3’) were used to amplify MAP3K7 from pDONR223-MAP3K7 plasmid (Addgene plasmid #23693) and cloned into the NotI and BamHI sites of lentiviral vector pHIV-Zsgreen (Addgene plasmid #18121 ...
-
bioRxiv - Cancer Biology 2020Quote: ... The sgRNA pairs were manually selected from the output list and cloned into the pGECKO backbone (CRISPRi.1: 5’ GTTACTTCCAACGTACCATG 3’, CRISPRi.2: 5’ CCTGTACCCCCATGGTACGT 3’) (Addgene 78534; (68))
-
bioRxiv - Cell Biology 2022Quote: A sgRNA construct targeting exon 2 of the human ACLY gene was made by inserting annealed, phosphorylated oligonucleotides (5′-CACCGGAATCGGTTCAAGTATGCTC-3′, 5′-AAACGAGCATACTTGAACCGATTCC-3′) into pSpCas9(BB)-2A-Puro (PX459, Addgene, plasmid 48139). The sgRNA construct was then transfected (2 μg ...
-
bioRxiv - Systems Biology 2019Quote: ... we performed inverse PCR using F primer (5’-TGAGCGGCCGCTAGGTACCTTTAA-3’) and R primer (5’-GGCACCGGGCTTGCGGGTCATGCA-3’) and pKLV-U6gRNA-EF(BbsI)-PGKpuro2ABFP (Addgene, Plasmid #62348) as a template ...
-
bioRxiv - Cell Biology 2020Quote: ... 5’- CGCGTCGACATGGTGAGCAAGGGCGAGGA-3’ and mCh REV: 5’-ACGCGGATCCCTTGTACAGCTCGTCCATGC-3’ and ligating it into pENTR4 no ccDB (gift from E. Campeau, Addgene plasmid #17424) plasmid (Campeau ...
-
bioRxiv - Developmental Biology 2021Quote: ... The fragment has been amplified using the primers F-5’-TGCAGGATCCCATCGATTCGGCCACCATGAAACGGACAG -3’ and R-5’-TAGAGGCTCGAGAGGCCTTGTCAGACTTTCCTCTTCTTCTTGG -3’) from the pCAG-CBE4max-SpG-P2A-EGFP plasmid (Addgene plasmid #139998)14 and from the pCAG-CBE4max-SpRY-P2A-EGFP plasmid (Addgene plasmid #139999)14.
-
bioRxiv - Genetics 2020Quote: ... oligonucleotides for gRNA synthesis (5’ TAGGAGGAAACTGTGCTCTTCA 3’ and 5’ AAACTGAAGAGCACAGTTTCCT 3’) were annealed and ligated into plasmid pDR274 (Addgene #44250, Watertown, MA). Purified plasmid DNA was digested with DraI (New England BioLabs ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5’-GCGCCTCCTGCGAAGCCATCAGG-3’ and 5’-CGTAGCGGGAAGGGTCAAGAGGG-3’) were similarly cloned into the lentiCRISPRv2-hygro vector (a gift from Brett Stringer, Addgene plasmid #98291)51.
-
bioRxiv - Molecular Biology 2022Quote: ... Single and double RNAi constructs targeting endogenous trap-1 and trap-3 were cloned by inserting the spliced coding sequences of trap-1 and trap-3 into vector L4440 (Addgene plasmid #1654). The constructs were then transformed into the RNAi feeding E ...
-
bioRxiv - Immunology 2023Quote: ... Next the LentiGuide-Puro plasmid [49] was used to express a single-guide RNA (CD58 sgRNA; 5’-GAGCATTACAACAGCCATCG-3’ and ICAM4 sgRNA: 5’-CCGGGAACACCTGCGTCACG-3’) LentiGuide-Puro (Addgene plasmid # 52963) was a gift from Feng Zhang ...
-
bioRxiv - Developmental Biology 2023Quote: ... sgRNAs 5’-CCCCATGGACATACCCACTG-3’ and 5’-CCAGTCGAGCAGAAAAGTGT-3’ defining a 244 bp region in Nodal exon 2 were cloned into pX458 (Addgene plasmid #48138) or pX459 (Addgene plasmid #48139 ...
-
bioRxiv - Genomics 2024Quote: ... 5’CTTCG-AATAGAATCGCCGCCCGCT3’;antisense:3’CTTATCTTAGCGGCGGGCGACAAA5’)and(se nse:5’CTTC-GTTGTGGCTGCACAGACTGG3’;antisense:3’CAACACCGACGTGTCTGACC-CAAA5’) into the pU6-BbsI-chiRNA plasmid (Addgene no. 45946), following the protocol outlined on the flyCRISPR website ...
-
bioRxiv - Genetics 2020Quote: ... and 3’ sgRNAs were cloned into lenti_sgRNA_EFS_GFP (Addgene 65656) vector ...
-
bioRxiv - Neuroscience 2020Quote: [3] 5XQUAS from pQUAST-mCD8-GFP (Addgene plasmid #24351) (Primers ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were transfected with GFP-tagged galectin 3 (Addgene) or a mutant variant of it ...
-
bioRxiv - Biophysics 2020Quote: ... human 3’ HP1α-AID-sfGFP 2A PuroR (Addgene 127906) and a guide RNA/Cas9 plasmid pX330 human 3’ HP1α gRNA (Addgene 127907 ...
-
bioRxiv - Genetics 2022Quote: ... were cloned into pCFD4-U6:1-U6:3 (Addgene® plasmid #49411 ...
-
bioRxiv - Neuroscience 2021Quote: ... with sgRNA (5’-CTTGTGGGGTCA-TGGTTTACAGG-3’) plasmid (Addgene, 68463), Cas9 plasmid ...
-
bioRxiv - Bioengineering 2020Quote: ... melanogaster U6:3 promoter fragment sequence amplified from Addgene plasmid #49411 23 with primers 1045.C1 and 1045.C2 ...
-
bioRxiv - Molecular Biology 2021Quote: ... human GFP-RBFOX2 (transcript variant 3) (Addgene, plasmid #63086) or empty vector (pcDNA 5 ...
-
bioRxiv - Neuroscience 2022Quote: ... 3) AAV1.hSyn.GCamP6s.WPRE.SV40 (6.67×1012 GC/kg, Addgene #100843). Before puncturing a capillary of interest ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 3 μg of plasmid VSVG (Plasmid #8454, Addgene). Cells were incubated at 37°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 3 μg of plasmid VSVG (Plasmid #8454, Addgene) in a 10 cm dish ...
-
bioRxiv - Neuroscience 2020Quote: ... In one C57BL/6 animal each we used AAV5-Syn-GCaMP6s or AAVrg-Syn-jGCaMP7f (Addgene, USA) with similar results to those obtained with GCaMP6f (Supplementary Fig ...
-
bioRxiv - Neuroscience 2023Quote: ... Control mice were injected with one of two control viruses: AAV9-hSyn-DIO-mCherry (AddGene Plasmid #50459), virus titer 2.17 x 1013 or AAV9-hSyn.HI.eGFP-Cre-WPRE-SV40 ...
-
bioRxiv - Neuroscience 2024Quote: 120 000 iPS cells were plated on 12-well plates one day before the transduction by lentiviruses pLV_TRET_hNgn2_UBC_Puro (Addgene: 61474) and pLV_hEF1a-rtTA3 (Addgene:61472 ...
-
bioRxiv - Developmental Biology 2021Quote: ... RD cells were transfected with the all-in-one Cas9/gRNA plasmid pSpCas9 BB-2A-GFP (PX458; Addgene; gRNA target sequence ...
-
bioRxiv - Cell Biology 2021Quote: The generation of stable knockout cell lines was achieved using the LentiCRISPRv2 system (one-vector system, Addgene #52961) or LentiGuide-Puro system (two-vector system ...
-
bioRxiv - Neuroscience 2022Quote: ... and one CaMKII mouse was infused with AAV9-synapsin-SomArchon-GFP (titer: 5.9×1012 GC/mL, Addgene #126941). PV mice (n=9 ...
-
bioRxiv - Plant Biology 2023Quote: ... in a one-step restriction-ligation reactions with a double CaMV35s-ΩTMV promoter/5′ UTR (pICH51288; Addgene #50269), a C-terminal GR tag (pEPOZ0CM0137 ...
-
bioRxiv - Cancer Biology 2023Quote: The one-step multiplex CRISPR-Cas9 assembly system kit was a gift from Takashi Yamamoto (Addgene Kit #1000000055) (2 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and TC-71 were transduced with lentiviral Tet-pLKO- puro all-in-one vector system (plasmid #21915, Addgene) containing a puromycin-resistance cassette ...
-
bioRxiv - Cell Biology 2020Quote: ... and the ER localization marker mCherry-ER-3 (Addgene: 55041) for 2 days ...