Labshake search
Citations for Addgene :
2401 - 2427 of 2427 citations for 2 Methyl 4 piperidin 1 ylsulfonyl phenylboronic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: Dynamin-1-mCherry and dynamin-1(K44A)-mCherry were made by replacing the GFP from WT Dyn1 pEGFP and K44A Dyn1 pEGFP (Addgene #34680 and #34681), respectively ...
-
bioRxiv - Microbiology 2020Quote: ... was obtained through Addgene as a ready-to-use lentiviral pooled library at a titer ≥ 1×107 TU/mL (Addgene, cat. #73178-LV). To deliver the Brunello sgRNA library ...
-
bioRxiv - Cancer Biology 2020Quote: OE19-dCas9-KRAB stable cells were generated by transfecting 1×106 OE19 cells with 7.5 μg Cas9 plasmid with guides targeting the AAVS1 locus (Addgene #42230; 5’-GGGGCCACTAGGGACAGGAT-3’) and 7.5 μg donor plasmid (pAAVS1-Puro-DNR ...
-
bioRxiv - Developmental Biology 2021Quote: ... with the only exception of ΔR2 and ΔF_ALL_Inv that were generated by using a pair of sgRNA. The guide sequences (listed in Supp. Table 1) were then cloned in px459 CRISPR/Cas9 vector (Addgene Cat. N. 62988), previously digested with Bbs1 ...
-
bioRxiv - Immunology 2020Quote: A short-guide RNA targeting the BFL-1 transcriptional start site was cloned into the BsmbI-digested dCas9-KRAB-GFP (Addgene #71237, RRID: Addgene_71237) or lentiguide-puromycin (Addgene #52963 ...
-
bioRxiv - Biophysics 2023Quote: The full-length α-synuclein monomer (1−140) expression plasmid (pET21a-alpha-synuclein) was a gift from Michael J Fox Foundation MJFF (Addgene plasmid # 51486). The α-synuclein monomer was expressed and purified following the previous method20,21 ...
-
bioRxiv - Neuroscience 2022Quote: ... Dual opsin-assisted circuit mapping and opto-tagging in brain slices: AAV2/-Syn-ChrimsonR-tdT (Addgene plasmid 59171, 1.3×1013 GC ml-1); AAV2/1-CAG-Flex-FlpO (made in house ...
-
bioRxiv - Neuroscience 2024Quote: The shRNA construct for mouse aldolase A was generated using oligos directed towards the 3’UTR of Aldoa (GCCCACTGCCAATAAACAACT) and control scrambled shRNA (CCGCAGGTATGCACGCGT) and cloned into the pLKO.1 cloning vector (Addgene Cat# 10878, RRID:Addgene_10878) and pCGLH vector for lentivirus and in utero electroporation experiments ...
-
bioRxiv - Neuroscience 2023Quote: ... Tetanus Neurotoxin Light Chain (TeLC) viruses were generated using AAV5-hSyn-FLEX-TeLC-P2A-dTomato (Addgene, 159102, 1 × 1013 genome copies per ml) at ISTA viral facility ...
-
bioRxiv - Molecular Biology 2024Quote: ... The synthetic sgRNA oligo pair complementary to exon 1 was designed and cloned into lentiCRISPRv2 vector (Addgene #52961, gift from Dr. Feng Zhang)143 following the published protocol.49 For virus production ...
-
bioRxiv - Neuroscience 2024Quote: ... All rats received bilateral microinjections of AAV2.CMV::nNOS-shRNA-EGFP or AAV2.CMV::luciferase-shRNA-EGFP (USC viral vector core: titer∼∼7×1013 vg/mL) combined with an AAV2.CAG::Flex-Ruby2sm-Flag.WPRE.SV40 (Addgene: titer: ∼1×1012 vg/ml) into the NAc ...
-
bioRxiv - Genetics 2024Quote: We use two constructs for epigenome editing: 1) dCAS9-DNMT3A/3L co-expressed with enhanced green fluorescent protein (eGFP) for selection 12 (Addgene, Catalogue number 128424), and 2 ...
-
bioRxiv - Neuroscience 2024Quote: ... sechellia nos-Cas9 (Auer et al., 2020) or co-injected with pHsp70-Cas9 (400 ng μl−1) (Addgene #45945; for D. simulans transgenesis) (Gratz et al. ...
-
bioRxiv - Cancer Biology 2024Quote: Human DSRCT cell lines JN-DSRCT-1 and SK-DSRCT2 were transduced with lentiviruses encoding the TET-pLKO-puro vector (Plasmid #21915, Addgene, Watertown, MA, USA) containing a puromycin resistance and doxycycline (DOX)-inducible expression cassette of short hairpin RNAs (shRNAs ...
-
bioRxiv - Neuroscience 2024Quote: ... the Cap gene of AAVhu.32 (GeneBank: AY530597.1) was synthesized (Sangon Biotech Co., Ltd., Shanghai, China) and ligated into the pAAV-RC2/1 vector (Addgene, Watertown, MA, USA, 112862). In the principle of point mutation ...
-
bioRxiv - Cancer Biology 2022Quote: For CRISPR/Cas9 knockout AMPK sgRNA plasmids targeting exon 1 of AMPK α1 and αβ (pX462-hPRKAA1-gRNA, pX462-hPRKAA2-gRNA, #74374-74377) were purchased from Addgene (Watertown, MA, USA). LNT-229 ...
-
bioRxiv - Cancer Biology 2022Quote: 293T cells were transfected with packaging plasmids (8 μg of pCMV-dR8.2 dVPR and 1 μg pCMV-VSV-G, a gift from Robert Weinberg, Addgene plasmid #8455 and 8454, respectively) along with shRNA plasmids (8 μg ...
-
bioRxiv - Neuroscience 2022Quote: ... To chemogenetically activate PVNOT neurons by means of DREADD we employed AAV2/1-DIO-hSYN1-hM3Dq-mCherry (Addgene # 44361; titer: 1.6 × 1013 gc/ml) versus a respective control virus AAV2/1-DIO-hSYN1-mCherry (Addgene # 50459 ...
-
bioRxiv - Developmental Biology 2024Quote: In-frame integration of Dendra2 into the C-terminus of apoBb.1 was achieved using TALENs as previously described and validated (56) (Addgene stock 128695 and 128696). TALENs were in vitro transcribed using the T3 Message Machine Kit (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... Control mice received injections of age-matched volumes of AAV1-pCAG-FLEX-eGFP-WPRE (Addgene 51502, final titer 1 x 1013 pp per mL) into RSC ...
-
bioRxiv - Cell Biology 2024Quote: ... The AH (ALPS1-ALPS2) of ArfGAP1 was amplified from pGEX-6P-1-hs-ALPS1-ALPS2-mCherry (a gift from Philipp Niethammer (Addgene plasmid # 187114; RRID: Addgene_187114); (Shen et al. ...
-
bioRxiv - Biochemistry 2021Quote: ... the cells were transfected with 1 μg of mutant library and 100 μg of Bxb1 expressing plasmid (pCAG–NLS–HA–Bxb1; Addgene #51271, a gift from Pawel Pelczar) in triplicate ...
-
bioRxiv - Neuroscience 2023Quote: Cre-dependent recombinant adeno-associated virus (rAAV) expressing GCaMP7f under the control of the Synapsin promoter (rAAV1-Syn-FLEX-jGCaMP7f-WPRE-Sv40, Addgene #104492, titer: 1 × 1013 vg/mL) was used to express GCaMP7f in interneurons.
-
bioRxiv - Molecular Biology 2024Quote: ... An 825 bp homology arm containing most of the POLQ promoter and an 800 bp homology arm containing most of POLQ exon 1 were amplified by PCR and inserted into pHD-w+ (Addgene 80927, gift from Kate O’Connor-Giles) (NEBuilder HiFi Assembly) ...
-
bioRxiv - Molecular Biology 2023Quote: The control vector pEGFP was generated by Gibson assembly 106 of the following DNA fragments: the EF-1 alpha promoter (amplified from pEF1a-mRor2WT, Addgene #2261, a gift from Roel Nusse 107) and the EGFP-ori-AmpR fragment (amplified from pCMV_ABEmax_P2A_GFP ...
-
bioRxiv - Cell Biology 2023Quote: ... U2OS cells expressing doxycycline (DOX)-activated DHFR-UBA5 were cotransfected with two plasmids: (1) pX330-U6-Chimeric BB-CBh-hSpCas9 (Addgene plasmid #42230, a gift from Feng Zhang), for expression of human codon-optimized SpCas9 and sgRNA UBA5 (ACCTACTATTGCTACGGCAA) ...
-
bioRxiv - Bioengineering 2023Quote: ... the neurons were transduced with 1 µL of an adeno-associated virus serotype 9 (AAV9) carrying a fluorescent calcium ion indicator GCaMP6s under a pan-neuronal human synapsin (hSyn) promoter (AAV9-hSyn::GCaMP6s, Addgene viral prep #100843-AAV9, >1×1013 IU/µL). After 5 days of incubation ...