Labshake search
Citations for Addgene :
2201 - 2250 of 2427 citations for 2 Methyl 4 piperidin 1 ylsulfonyl phenylboronic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... 100,000 HeLa M cells were plated per well in a 6-well plate and transfected the following day at a ratio of 1:15 with the pEGFP-Puro plasmid (45561; Addgene) and gRNA-containing plasmid (pX330A-1×2) ...
-
bioRxiv - Cell Biology 2024Quote: ... of ArfGAP1 was amplified from pGEX-6P-1-hs-ALPS1-ALPS2-mCherry (a gift from Philipp Niethammer (Addgene plasmid # 187114; RRID: Addgene_187114); (Shen et al. ...
-
bioRxiv - Bioengineering 2024Quote: ... the kanamycin-resistance gene AphAI flanked by an I-SceI restriction site (I-SceI-AphAI fragment) was amplified using primers 5 and 6 listed in Supplementary Table 1 from pEPkan-S (Addgene plasmid #41017 ...
-
bioRxiv - Cell Biology 2024Quote: PS-DKO cells were transfected with the truncated mature form of SREBP2 (2xFLAG-SREBP2, aa 1-482, Addgene plasmid #26807), which is targeted to the nucleus where it activates cholesterol biosynthesis gene programs ...
-
bioRxiv - Cancer Biology 2024Quote: 3x105 parental and clonally derived Cas9-expressing OCI-AML2 or PANC-1 cells were infected with pXPR_011 (Addgene Plasmid #59702) virus as described above ...
-
bioRxiv - Cancer Biology 2024Quote: Lentivirus was produced by cotransfection of a lentiviral vector (pLJM1, pLVX, pLKO.1) and the packaging plasmids psPAX2 (Addgene #12260) and pMD2.G (Addgene #12259 ...
-
bioRxiv - Cancer Biology 2021Quote: ... The shRNAs targeting HDAC1 (5′-CTATGGTCTCTACCGAAAA-3′) and HDAC3 (5′-GCATTGATGACCAGAGTTA-3′) were cloned into pLKO.1-TRC lentiviral vector (Addgene, #10878). For generation of lentivirus ...
-
bioRxiv - Cell Biology 2020Quote: FACS EPCAM+ stromal depleted organoids at d14 were infected with lentivirus at an estimated MOI of 0.9 according to Van Lidth de Jeude et al.72 with third generation lentiviral vectors (PGK-GFP T2A Puro, SBI cat# CD550A-1; mCherry modified from pLentiCRISPRv1 (Addgene #49545) to incorporate an EF-1a-mCherry P2A Puro cassette ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Site-directed integration into attP sites was achieved by co-injection of an attB-containing vector (400 ng µl-1) and pBS130 (encoding phiC31 integrase under control of a heat shock promoter (Addgene #26290) [73]) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The first fragment was amplified using p15-Cam-F and p15-Cam-R (Table 1) from the plasmid pEVOL-pBpF (Addgene #31190), and the second fragment was obtained from the pBAD/HisB vector (Invitrogen ...
-
Rab35 Governs Apicobasal Polarity Through Regulation of Actin Dynamics During Sprouting AngiogenesisbioRxiv - Developmental Biology 2022Quote: ... and Linearized pShuttle-CMV plasmids were transformed into the final viral backbone using electrocompetent AdEasier-1 cells (gift from Bert Vogelstein; Addgene, #16399). Successful incorporation of pShuttle-CMV construct into AdEasier-1 cells confirmed via digestion with PacI (ThermoFisher) ...
-
bioRxiv - Cell Biology 2020Quote: Knockdown of TPM1 was performed using the pLKO.1 plasmid lentiviral backbone (a kind gift from Bob Weinberg, Addgene plasmid #8453) either encoding an shRNA with sequence complementary to TPM1 (shTPM1 ...
-
bioRxiv - Bioengineering 2021Quote: ... The nCas9(D10A) was generated by the PCR method using previously optimized Cas9 as a template (Level 1 hCas9 module, Addgene #49771). Desired sgRNA sequence was PCR amplified using plasmid pICH86966::AtU6p::sgRNA_PDS (Addgene #46966 ...
-
bioRxiv - Biochemistry 2021Quote: ... shRNA targeting mSARM1 (5’-CCGGCTGGTTTCTTACTCTACGAATCTCGAGATTCGTAGAGTAAGAAACCAGTTTTTG-3’) or the scrambled shRNA (5’-CCGGCCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGGTTTTTG-3’) were inserted to pLKO.1-puro (Addgene, #8453) with EcoRI and AgeI ...
-
bioRxiv - Cell Biology 2021Quote: The components for each of the individual optogenetic sensors were first assembled in Level 1 destination vectors included in the MoClo Toolkit (Addgene #1000000044) by Golden Gate (GG ...
-
bioRxiv - Biochemistry 2021Quote: Expression cassette comprising of genes encoding PEPCK along with 1 kb of its promoter was cloned into pIB3 vector (cat # 25452, Addgene, USA) and expressed in P ...
-
bioRxiv - Cell Biology 2021Quote: ... Mito-mCh-1×FLAG and Mito-mCh-smFLAG were constructed by ligating 1×FLAG synthesized by overlapping PCR and smFLAG amplified from smFLAG-KDM5B-24×MS2 (Addgene # 81084) with previously built Mito-mCh-1×HA cut by BglII and BamHI through Gibson Assembly.
-
bioRxiv - Cell Biology 2021Quote: ... U2OS cells seeded on 35mm MatTek chambers with 70% confluency were loaded with 1 µg of smFLAG-KDM5B-24×MS2 (Addgene #81084), 0.5 µg of anti-FLAG FB-GFP and 130 ng of purified MCP-HaloTag protein by bead loading (Cialek et al. ...
-
bioRxiv - Cell Biology 2021Quote: A codon-optimised sequence for full-length USP7 (USP7FL) was cloned into pGEX6p-1 using BamHI/NotI restriction sites (Addgene, #63573). Mutations at S18 were introduced using partially overlapping primers with Phusion Flash polymerase (Thermo Fisher Scientific) ...
-
bioRxiv - Systems Biology 2020Quote: ... We then used lentivirus to stably integrate pCMV-DHB-mCherry or pCMV-mCherry-Geminin(1-110)-P2A-mCitrine-Cdt1(30-120) in pLenti-Puro (Addgene: 39481). Cells were screened with puromycin and sorted by FACS to generate monoclonal cell lines.
-
bioRxiv - Neuroscience 2020Quote: Cortical pyramidal neurons (CPN)s in WT and YAC128 cultures were labeled by transfecting a subset of neurons (1 of 2.7 million) with a cytoplasmic green fluorescent protein (GFP) (Addgene plasmid 37825) at the time of platting ...
-
bioRxiv - Genomics 2021Quote: ... Corresponding DNA oligonucleotides with BbsI overhangs (sequences are listed in Suppl. Table 1) were annealed and ligated with pre-digested pSPgRNA plasmid (Addgene, # 47108). HEK293T17 cells (ATCC ...
-
bioRxiv - Molecular Biology 2022Quote: FLAG-NKX2-1 or FLAG-GFP open reading frame (ORF) was cloned into pLEX_306 (a gift from David Root, Addgene plasmid #41391). Cells stably expressing Cas9 were generated by infection with the lentiCas9-Blast plasmid (Addgene # 52962 ...
-
bioRxiv - Cell Biology 2022Quote: ... The Capping Protein (F-actin-capping protein subunit alpha-1 and F-actin-capping protein subunit beta) plasmid was a gift from Antoine Jégou & Guillaume Romet-Lemonne (Addgene plasmid #89950).
-
bioRxiv - Cancer Biology 2022Quote: ... The double strand DNA coding HMGN5 shRNA and STAT3 shRNA were synthesized by Sangon Biotech (Shanghai, China) and cloned into the lentiviral vector pLKO.1-Puro (Addgene, 8453).
-
bioRxiv - Cell Biology 2022Quote: ... a 20bp guide sequence targeting the 5’ end of WNK1 exon 1 was ligated to the BbsI site of PX459 (Addgene #62988). In addition ...
-
bioRxiv - Immunology 2022Quote: Lentiviruses pseudotyped with HIV-1 env were prepared by transfecting the Lenti-X 293T cells with pCMV-dR8.3 Δvpr (Addgene plasmid #8455), pLOX-CW-tdTomato ...
-
bioRxiv - Microbiology 2021Quote: ... hairpin loop sequence and shRNA sequence were synthesised (IDT technologies) and annealed oligos cloned into pLKO.1 TRC cloning vector (Addgene #10878) using the unique Age1/EcoR1 sites ...
-
bioRxiv - Neuroscience 2020Quote: Plasmid Cry2olig-mCherry-tau 1-441 was prepared by inserting DNA fragment encoding the full length tau into the linearized Cry2olig-mCherry (Addgene 60032) backbone at the C-terminus of mCherry using Gibson assembly® Cloning kit (New England BioLab Int.) ...
-
bioRxiv - Developmental Biology 2020Quote: ... MCP-TagRFPT constructs were assembled by replacing the eGFP fragment of pNosPE_MCP-eGFP using NheI/BamHI with the TagRFPT coding sequence amplified by PCR (supplementary table 1) from TagRFP-T-Rabenosyn-5 (Addgene 37537). MCP-TagRFPT-NLS was generated by insertion of the TagRFPT-NLS coding sequence into pNosPE_MCP-eGFP with NEBuilder® HiFi DNA Assembly Master Mix (primers listed in supplementary table 1).
-
bioRxiv - Molecular Biology 2020Quote: ... The annealed oligos were diluted (1:200) and cloned into pLV hU6-sgRNA hUbC-dCas9-KRAB-T2a-Puro (encoding dCas9-KRAB; Addgene # 71236) using a Golden Gate Assembly strategy (containing ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tetracycline-inducible TET-shRB1 and constitutive shRB1 constructs were created by integrating validated siRNA sequences GAAAGGACATGTGAACTTA (63) and GAACGATTATCCATTCAAA (64) targeting human RB1 (shRB1) into TET-pLKO.1-Puro vector (Addgene #21915) and pLKO.1-Puro vector ...
-
bioRxiv - Cancer Biology 2021Quote: ... plasmids were created by integrating validated siRNA sequences CCTGTCAGGAAACTGTATGAT (62) and AATGGCCATCAGAACGGACTT targeting human ESRRG (shESRRG) into pLKO.1-Puro vector (Addgene #8453). Non-specific siRNA sequence AACAGCCACAACGTCTATATC or siRNA sequence CAACAGCCACAACGTCTATAT targeting GFP were used as controls for shRNA ...
-
bioRxiv - Neuroscience 2021Quote: ... Twenty hemizygous ChAT-Cre mice were bilaterally injected with Cre-dependent inhibitory DREADD fused with mCherry reporter AAV8-hsyn-DIO-hM4Di-mCherry (1×1013 VG/ml; Addgene, 44362) or control virus (AAV8-hsyn-DIO-mCherry ...
-
bioRxiv - Cancer Biology 2021Quote: MEFs were seeded in 6-well plates and transfected for 6-8 h with 1 μg of plasmid 4XCLEAR-luciferase reporter (Addgene, 66800) and 0.1 ug of CMV-Renilla Luciferase (Promega ...
-
bioRxiv - Cancer Biology 2022Quote: The human NOTCH 1 intracellular domain (h1NICD) doxycycline-inducible expression plasmid (pLIX-h1NICD) was a gift from Julien Sage (Addgene #91897)11 ...
-
bioRxiv - Immunology 2022Quote: ... Vector psPAX2 containing the untagged coding sequence for HIV-1 gag-pol was a gift from Didier Trono (Addgene plasmid # 12260).
-
bioRxiv - Cell Biology 2022Quote: All shRNA were generated by ligation of oligos into AgeI and EcoRI of pLKO.1 (Addgene plasmid #8453; Addgene, Teddington, UK). Lower case sequences represent the targeted sequences.
-
bioRxiv - Cell Biology 2022Quote: All shRNA were generated by ligation of oligos into AgeI and EcoRI of pLKO.1 (Addgene plasmid #8453; Addgene, Teddington, UK). Lower case sequences represent the targeted sequences.
-
bioRxiv - Cancer Biology 2020Quote: shRNA targeting CDK9 was cloned into pLKO.1 lentiviral vector (Sequence: Forward: CCGGGTTCGACTTCTGCGAGCATGACTCGAGTCATGCTCGCAGAAGTCGAACTTTTG Reverse:AATTCAAAAAGTTCGACTTCTGCGAGCATGACTCGAGTCATGCTCGCAGAA GTCGAC. Luciferase vector was purchased from Addgene (plasmid #17477). Recombinant lentiviral vector and packaging vector (pCMV-dR8.9 and pMD2.G-VSVG ...
-
bioRxiv - Cell Biology 2020Quote: Oligo duplexes containing a single guide (sg)RNA sequence for ACLY (as shown in Figure 1-figure supplement 1A) were inserted into pCas9(BB)-2A-GFP (a gift from Feng Zhang, Addgene #48138) following the published procedures (Ran et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... Nfia/bxlox/lox;Sun1-sGFP and GLASTCreERT2;Sun1-sGFP control mice were intravitreally injected with 1 μl of AAV9-pCAG-Flex-Tdtomato (Addgene #28306) at 1×10¹³ vg/mL and treated with Tamoxifen diet for 3 weeks ...
-
bioRxiv - Cell Biology 2020Quote: The Fucci reporter construct (pLL3.7m-Clover-Geminin(1-110)-IRES-mKO2-Cdt(30-120)) was a gift from Michael Lin (Addgene plasmid #83841)35 ...
-
bioRxiv - Cell Biology 2020Quote: ... A glass capillary with a fine tip containing plasmid solution is inserted into the eye primordium of stage 26-30 embryos to inject 8−5-8 nl doses of 1 µg/µl of pEGFPC1-hVAP-A (Addgene #104447) or pEGFPC1-hVAP-A KD/MD (Addgene #104449 ...
-
bioRxiv - Immunology 2021Quote: ... HEK293T cells were seeded in 6-well plates and the next day transfected with 1 μg psPAX2 packaging plasmid (Addgene 12260), 500 ng pMD2.G VSV-G envelope plasmid (Addgene 12259 ...
-
bioRxiv - Cell Biology 2021Quote: ... A gBlock containing sequence for SNAP-V5 tags was inserted into pLenti CMVTRE3G eGFP Blast (w818-1) (gift of Eric Campenau, Addgene #27568) at the AgeI restriction site using Gibson Assembly to make pLTRE3G-SNAP-V5-eGFP ...
-
bioRxiv - Molecular Biology 2021Quote: ... CUG-targeting and non-targeting short hairpin RNAs (shRNAs) matching the corresponding Cas13d spacer sequences were cloned into the pLKO.1 vector (Addgene, #10878) by AgeI and EcoRI digestion and ligation of 5’-phosphorylated DNA duplexes using T4 DNA ligase (NEB ...
-
bioRxiv - Cancer Biology 2021Quote: ... were amplified using primers containing overhangs with the homology sites for GMAP cloning and inserted into a lentiviral vector (LV 1-5, Addgene, 68411). This lentiviral backbone was a gift from Dr ...
-
bioRxiv - Immunology 2020Quote: ... Selected gRNAs shown in Figure 1 B and C were synthesized by IDT and cloned into eSpCas9(1.1) (a gift from Feng Zhang Addgene plasmid # 71814). The LC donor DNA of HuGL18 was designed as follows from 5′ to 3′ ...
-
bioRxiv - Cell Biology 2020Quote: Lentiviruses were produced by co-transfecting 1 μmol of pLOVE-mEmerald-MCAK or pLOVE-mEmerald-MCAK-mCherry with the packaging plasmids dRT-pMDLg/pRRE (Addgene #60488), pRSV-Rev (Addgene #12253) ...