Labshake search
Citations for Addgene :
2351 - 2400 of 2933 citations for Mouse Macrophage expressed gene 1 protein MPEG1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2023Quote: ... pAAV-GfaACC1D.Lck-GCaMP6f.SV40 (1.53×1013 vg/ml, working dilution 1:5, Addgene plasmid #52925-AAV5; http://www.addgene.org/52295/; RRID: Addgene_52925) was a gift of Baljit Khak ...
-
bioRxiv - Synthetic Biology 2022Quote: ... we have cloned their respective oligonucleotides in following vectors: PDX1 in pX330A-1×5 (Plasmid #58769, Addgene), NKX6.1 in pX330S-2 (Plasmid #58778 ...
-
bioRxiv - Neuroscience 2024Quote: ... GABAergic interneuron targeting was achieved with 0.45 µl of AAV1-1/2mDlx-HBB-hChR2-mcherry (Addgene 83898) (viral titer 7×1012 vg per ml ...
-
bioRxiv - Neuroscience 2024Quote: ... stereotactic injection of EnVA-CVS-N2c-dG-H2B-tdTomato (70 nL; dilution 1/10, Addgene plasmid: #175441)19 was performed at P30 in animals previously injected with AAV-3xgRNA-DIO-TVA-N2cG at P0 (80 nl) ...
-
bioRxiv - Neuroscience 2023Quote: ... human CaV2.2 (huCaV2.2 (pSAD442-1) was a gift from Diane Lipscombe (Addgene plasmid # 62574; http://n2t.net/addgene:62574; RRID:Addgene_62574)) ...
-
bioRxiv - Developmental Biology 2024Quote: ... The HDR plasmid containing ippk-1 homology arms and the GFP and selection cassette (pDD282, Addgene #66823) was made using Gibson Assembly as described in Dickinson et al ...
-
bioRxiv - Biochemistry 2023Quote: Lentiviral vector pLH3 was constructed by replacing the U6 promoter in pLKO.1 GFP shRNA (Addgene #30323) with the CMV promoter in pKH3 (Addgene #12555 ...
-
bioRxiv - Microbiology 2023Quote: ... An inducible GFP was made by inserting the Yersinia operon 1 promoter sequence into plasmid pFCcGi (Addgene) upon restriction with HindIII and XbaI (NEB) ...
-
bioRxiv - Microbiology 2023Quote: ... was combined with 1 ug lenti CRISPR V2 plasmid (a gift from Feng Zhang, Addgene plasmid #52961) expressing the guide RNA (gRNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... was generated by Gibson assembly of the following fragments: the EF-1 alpha promoter (from Addgene #2261), the Kozak-3XFLAG fragment (from c3GIC9 ...
-
bioRxiv - Cancer Biology 2023Quote: ... pLenti-CMV-GFP-Blast (659-1) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid # 17445). pRL-SV40P was a gift from Ron Prywes (Addgene plasmid # 27163) ...
-
bioRxiv - Cancer Biology 2023Quote: ... A CRISPR/dCas9 vector was constructed as follows: pX330A_dCas9-1×2 (Addgene, Watertown, MA; plasmid ID 63596) (20 ...
-
bioRxiv - Neuroscience 2023Quote: ... to induce expression of Voltron2-ST and a 1:150 dilution of AAV9-hSyn-Cheriff-EGFP (Addgene plasmid #51697 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Sequences (shPROX1-1: TGCTGTTGACAGTGAGCGCGAGGACCAAGATGTCATCTCATAGTGAAGCCACAGATGTATGAGATGAC ATCTTGGTCCTCATGCCTACTGCCTCGGA; shPROX1-2: TGCTGTTGACAGTGAGCGCCCCCGAGAAAGTTAC AGAGAATAGTGAAGCCACAGATGTATTCTCTGTAACTTTCTCGGGGATGCCTACTGCCTCGGA) were cloned into the LT3GEPIR backbone100 (Addgene; 111177) and used to generate lentiviral particles to transduce into organoids as described99 ...
-
bioRxiv - Developmental Biology 2023Quote: ... CRISPR guide RNAs (gRNAs) targeting exon 1 of SLC25A1 were subcloned into lentiCRISPR v2 (Addgene Plasma 52961) using BbsI sites as described.33,40 Non-targeting guides were generated using previously reported sequences.
-
bioRxiv - Genomics 2022Quote: ... The open reading frames of H3 and H4 were cloned in the Dox-inducible expression vector KA0717 (KA0717_pPB-hCMV*1-cHA-IRESVenus was a gift from Hans Schöler, Addgene plasmid #124168; http://n2t.net/addgene:124168; RRID:Addgene_124168) fused at their 3’ end in frame to the sequence of the yellow fluorescent protein (YFP ...
-
bioRxiv - Developmental Biology 2023Quote: ... nls::Cas9::nls (subcloned from Eef1a-1955/- 1>nls::Cas9::nls a gift from Lionel Christiaen, Addgene plasmid # 59987 ;http://n2t.net/addgene:59987 ...
-
bioRxiv - Neuroscience 2023Quote: 1-4 evenly spaced ∼60 nl injections of the AAV1-synapsin-l-GCamp6f (Addgene, MA stock #100837) that had been diluted to a titer of ∼1×10^12 vg/mL using sterile PBS were made in each cranial window ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... coding for the large T oncogene SV40 (V40 1: pBSSVD2005 was a gift from David Ron; Addgene plasmid #21826 ...
-
bioRxiv - Cancer Biology 2023Quote: ... pLenti CMV GFP Blast (659–1) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid # 17445). pHAGE-PIK3CA-H1047L was a gift from Gordon Mills & Kenneth Scott (Addgene plasmid # 116499 ...
-
bioRxiv - Cancer Biology 2023Quote: ... High complexity barcoding library LARRY Barcode Version 1 library79 was a gift from Fernando Camargo (Addgene #140024). Retroviral stocks were generated using pCL-Eco plasmid ...
-
bioRxiv - Plant Biology 2023Quote: ... fw2.2-sgRNA-1 and fw2.2-sgRNA-2 were fused to the Arabidopsis AtU6-26 promoter (Addgene #46968) by digestion-ligation reaction in plCH47751 (Addgene #48002 ...
-
bioRxiv - Cancer Biology 2023Quote: the NF1 isoform 1 recombinant protein was produced in insect cells starting from the plasmid R702-X38-635 encoding for His6-Hs.NF1opt (1-2839) (a gift from Dominic Esposito; http://n2t.net/addgene:159576; RRID:Addgene_159576) 33 ...
-
bioRxiv - Molecular Biology 2023Quote: shRNA oligonucleotides targeting FEN1(shown in the following table) were cloned into pLKO.1 (Cat# 8453, Addgene) digested with EcoRI and AgeI ...
-
bioRxiv - Microbiology 2023Quote: ... The wild-type (Flag-SIRT1) and mutant (Flag-SIRT1 H363Y) SIRT-1 plasmids were purchased from Addgene and transfected into cells using Lipofectamine 2000 ...
-
bioRxiv - Microbiology 2023Quote: pLKO.1 puro was a gift from Bob Weinberg (Addgene plasmid # 8453; http://n2t.net/addgene:8453; RRID:Addgene_8453)75 ...
-
bioRxiv - Cancer Biology 2024Quote: ... and EGFP control (See Supplemental Table 1 for sgRNA sequences for each)) into lentiCRISPR v2 (Addgene #52961). For individual gene knockouts pooled libraries of up to four sgRNAs were generated ...
-
bioRxiv - Plant Biology 2024Quote: ... Binomica Labs) with primers for Golden Gate assembly into the Level 1 pICH47742 plasmid (Addgene catalog # 48001) with a double 35S promoter (pICH51277 ...
-
bioRxiv - Neuroscience 2024Quote: ... Each coverslip was transfected with 1 μg of either GFP or HA-UBE3A plasmid (Addgene, cat. #8648), and 1 μL Lipofectamine 2000 ...
-
bioRxiv - Neuroscience 2024Quote: ... PV-ChR2 mice were injected with 1µl of AAV-CaMK2-GCaMP6f (Addgene, #100834-AAV9, dilution 1/15) at 0.75µl.min−1 in the left primary auditory cortex (centered at 1.75 mm anterior to the inter-section of the lambdoid and interparietal-occipital sutures ...
-
bioRxiv - Neuroscience 2024Quote: ... n=2) or AAV9.EF1a.dflox.hChR2(H134R).EYFP.WPRE.HGH (1×10^12 pp/mL, Addgene, cohort 2, n=2). Subject mice were additionally injected in vCA2 (AP −3.0 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and Clover-Geminin(1-110) were a gift from Michael Lin (Addgene plasmid # 83915; http://n2t.net/addgene:83915; RRID:Addgene_83915 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Plasmids to overexpress tRNAIle or with shRNAs targeting tRNAIleGAU were cloned into the plko.1 puromycin (Addgene # 8453) or blasticidin (Addgene #26655 ...
-
bioRxiv - Cell Biology 2020Quote: ... pGEX6P1-human LIC1 G domain (GST-LIC 1-389) was a gift from Ron Vale (Addgene plasmid # 74598; http://n2t.net/addgene:74598; RRID:Addgene_74598) (Schroeder et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... DNA sequences between nucleotides 1-3877 and 4236-4617 were PCR amplified from V5-GFP-P180 (Addgene #92150) and the two fragments were assembled and cloned into pEGFP(A206K)-N1 between XhoI and BamHI sites by GIBSON assembly ...
-
bioRxiv - Cell Biology 2022Quote: ... Plasmid mixes to produce HIV-1 viral particles consisted of 0.4 μg CMV-VSVG (pMD2.G; 12259; Addgene) and 2.6 μg of HIV proviral plasmid ...
-
bioRxiv - Microbiology 2022Quote: ... or pLKO.1-blast (pLKO.1-blast was a gift from Keith Mostov (Addgene plasmid #26655; http://n2t.net/addgene:26655; RRID:Addgene_26655).
-
bioRxiv - Microbiology 2022Quote: ... All shRNAs were generated by cloning shRNA hairpin sequences found in Table 3 into pLKO.1-TRC Puro (pLKO.1-TRC cloning vector was a gift from David Root (Addgene plasmid # 10878; http://n2t.net/addgene:10878; RRID:Addgene_10878) or pLKO.1-blast (pLKO.1-blast was a gift from Keith Mostov (Addgene plasmid #26655 ...
-
bioRxiv - Neuroscience 2021Quote: Mice were injected with 100nL of retrograde AAV-Syn-eGFP (Titer: 1×1013 GC/mL, Lot#V16600, Addgene) in PF (N=6) ...
-
bioRxiv - Neuroscience 2021Quote: ... The pcDNA3.1-SARS2-Spike plasmid was a gift from Fang Li (Addgene plasmid # 145032; http://n2t.net/addgene:145032; RRID:Addgene_145032) 39 ...
-
bioRxiv - Neuroscience 2021Quote: ... working dilution 1:5) was a gift from Douglas Kim (Addgene viral prep #100833-AAV9; http://n2t.net/addgene:100833; RRID:Addgene_100833). pAAV5-hSyn-dLigh1.2 (titer ≥ 4×1012 vg/ml ...
-
bioRxiv - Genomics 2022Quote: ... Per transfection reaction we used 7.5ul of 1 mg/mL polyethyleneimine (PEI) and 2.325 μg of total plasmid DNA (825 ng psPAX2: Addgene #12260 ...
-
bioRxiv - Neuroscience 2019Quote: A 60 nl viral mix containing a 3:1 ratio of AAV2retro-Cre (AAVrg-pmSyn1-EBFP-cre, Addgene) and AAV2-GFP (UNC viral core ...
-
bioRxiv - Cell Biology 2019Quote: ... pcDNA3.1-MYO10-HMM-Nanotrap was a gift from Thomas Friedman (Addgene plasmid # 87255; http://n2t.net/addgene:87255; RRID:Addgene_87255) [Bird et al ...
-
bioRxiv - Immunology 2021Quote: ... To be consistent with the pHDM-Wuhan-Hu-1-delta21 and pHDM-D614G-delta21 plasmids obtained from Addgene, the c-terminal 21 amino acid on all the variants were deleted (Crawford et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... was generated by ligating oligonucleotides containing the targeting sequence 5’-CAGTTCCTGGGTGGAGCTA-3’ into pLKO.1-puro (Addgene # 8453). The mitochondrial (CMV-mitoCAR-GECO1 ...
-
bioRxiv - Cell Biology 2020Quote: ... SKO cells were transfected with pSH-EFIRES-P-GFP(1-10)opti AAVS1 Safe Harbor integration plasmid (Addgene plasmid # 129416 ...
-
bioRxiv - Neuroscience 2021Quote: ... Yzhar) or 250 nl of AAV1-syn-FLEX-jGCaMP7s-WPRE (titer: 1×1012 vg/ml Addgene #104487-AAV1).
-
bioRxiv - Microbiology 2021Quote: Lentiviral stocks were generated by co-transfection of 1 μg plentiCRISPRv2 (a gift from Dr. Feng Zhang (Addgene plasmid #52961; http://n2t.net/addgene:52961; RRID:Addgene_52961)) ...
-
bioRxiv - Microbiology 2021Quote: Lentiviral stocks were generated by co-transfection of 1 μg plentiCRISPRv2 (a gift from Dr. Feng Zhang (Addgene plasmid #52961 ...