Labshake search
Citations for Addgene :
2601 - 2650 of 2933 citations for Mouse Macrophage expressed gene 1 protein MPEG1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... talin 2 shRNA-stable cells were co-transfected with Tln1 siRNA and EGFP-talin 1 head (Addgene plasmid no. 32856) or EGFP-talin 1 L325R (the mutant version ...
-
bioRxiv - Neuroscience 2021Quote: Other viruses used in the paper: AAV2/1-hSyn-hChR2(H134R)-EYFP was a gift from Karl Deisseroth (Addgene #26973); AAV2/1-hSyn-hM3D(Gq)-mCherry was a gift from Bryan Roth (Addgene #50474) ...
-
bioRxiv - Cell Biology 2021Quote: ... Exogenous cells - MDCK cells were mosaically transfected using a CMV GFP vector (pLenti CMV GFP Blast (659-1) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid #17445 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The plasmid 6His-MBP-TEV-huLbCpf1 (plasmid # 90096) (see Figure.1 and Supplementary M3 in the Supplement Data) was purchased from Addgene. After extracted from amplified strains ...
-
bioRxiv - Immunology 2020Quote: ... with lentiviral packaging vectors pCAG-eco and psPAX.2 plus empty pLKO.1 control (EV) with a puromycin selection cassette (all obtained from Addgene) or a shRNA containing pLKO.1 targeting DGAT1 (GE Dharmacon CAT# RMM4534-EG13350 - TRCN0000124791) ...
-
bioRxiv - Cancer Biology 2020Quote: Primary dMMR mouse or human organoids were generated using lentiviral transduction as described previously.25,30 Lentivirus was prepared as previously described using the pLKO.1 system (Addgene #10878) and containing the shRNA sequences in Supplementary Table 1.24 Lentivirus was concentrated 100X by ultracentrifugation ...
-
bioRxiv - Neuroscience 2020Quote: ... The loxP-NeoR-loxP cassette was inserted at the MluI site in the intron between exons 1 and 2 following PCR amplification from pL452 (Addgene) using primers 3-For and 3-Rev ...
-
bioRxiv - Plant Biology 2022Quote: ... The first step involved the cloning of the tobacco sgRNA expression vectors (pYPQ131c, pYPQ132c, and pYPQ133c (Addgene, USA; Table 1) that contained the sgRNAs as inserts ...
-
bioRxiv - Immunology 2022Quote: ... with lentiviral packaging vectors pCAG-eco and psPAX.2 plus empty pLKO.1 control (EV) with a puromycin selection cassette (all obtained from Addgene) or a shRNA containing pLKO.1 targeting Cpt1a (GE Dharmacon CAT# RMM3981-201819967 – TRCN0000110596 ...
-
bioRxiv - Cell Biology 2022Quote: ... was constructed by recombining pENTR1a emGFP-Slc37a2 iso 2 with the pLenti PGK Hygro DEST (w530-1) vector (a gift from Eric Campeau and Paul Kaufman, Addgene plasmid # 19066 ...
-
bioRxiv - Immunology 2022Quote: ... annealed oligos were diluted 1:20 in molecular grade H2O and then ligated into Esp3I-digested pLentiCRISPR V2.0 (Addgene #52961). Ligation reactions were then transformed into Top10 competent E ...
-
bioRxiv - Cancer Biology 2019Quote: ... the HFF-1 cells were lentivirally transduced with GFP-H2B nuclear marker using the PGK-H2BeGFP system as described by Addgene and selected by flow sorting for GFP positive cells.
-
bioRxiv - Cell Biology 2019Quote: ... Annealed oligos were diluted 1/40 and 1 μl of insert was ligated into 10 ng of digested vector (pU6-sgRNA EF1Alpha-puro-T2A-BFP, Addgene plasmid #60955 digested with BstXI and Blpl ...
-
bioRxiv - Cell Biology 2019Quote: ... IRES DNA and mCherry cDNA were prepared by PCR using pEYFP SUMO-1 plasmid (from Mary Dasso: Addgene plasmid #13380), pWPI plasmid (from Didier Trono ...
-
bioRxiv - Microbiology 2020Quote: ... or human ACE2 ectodomain (containing a C-terminal His tag) were made according to the E and F sections of the pLKO.1 Protocol from Addgene (http://www.addgene.org/protocols/plko/) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and plasmids were obtained from Open Biosystems or cloned using pLKO.1-TRC (a gift from Dr. David Root (Addgene # 10878; http://n2t.net/addgene:10878; RRID: Addgene 10878)) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and plasmids were obtained from Open Biosystems or cloned using pLKO.1-TRC (a gift from Dr. David Root (Addgene # 10878 ...
-
bioRxiv - Neuroscience 2021Quote: ... mDlx-Azurite was generated by replacing EGFP with Azurite from the pAAV-mDlx-GFP-Fishell-1 plasmid (Addgene number: 83900). Generation of pORANGE Btbd11 constructs were generated using the pORANGE Cloning template vector (Addgene number ...
-
bioRxiv - Molecular Biology 2020Quote: ... The four guide sequences for the Ascl1 locus (see Table 1) were taken from (Black et al., 2016) and cloned into pmU6-gRNA (Addgene: 53187 ...
-
bioRxiv - Neuroscience 2020Quote: ... CMV-PercevalHR (1×1010 TU/mL, produced at the University of North Carolina Vector Core Facility based on plasmid # 49083, Addgene, kindly provided by Dr ...
-
bioRxiv - Microbiology 2021Quote: ... and pCT-CD63-GFP (SBI, CYTO120-PA-1) plasmids were transfected in HEK293T cells with the packaging plasmids pMD2.G (Addgene; number 12259 ...
-
bioRxiv - Neuroscience 2020Quote: To express oChIEF-mCitrine in pOXR1-Cre mice, a recombinant adeno-associated virus (rAAV, serotype 1, 4.8×1013 VC/ml titer) expressing FLEXed oChIEF-mCitrine (Addgene #50973) was package by Vector Biolabs (Malvern ...
-
bioRxiv - Immunology 2021Quote: ... par-5 and his-1 cDNA were subcloned into pCE-BiFC-VN173 and pCE-BiFC-VC155 plasmids (Addgene, Cambridge, MA), which contain the heat shock promoter Phsp-16.41 ...
-
bioRxiv - Cell Biology 2021Quote: ... The constitutively active form of kinesin-1 (human KIF5B, K560) was cloned by PCR from pet17-K560-GFP_His (Addgene, 15219) into pEGFP-N1 vector using EcoRI primer (104-5p EcoRI-K560 ...
-
bioRxiv - Biochemistry 2021Quote: Site-directed mutagenesis was performed on KRAS 1-169 (Q61H, isoform b, a gift from Cheryl Arrowsmith, Addgene plasmid #25153) to obtain the wild-type sequence ...
-
bioRxiv - Genomics 2021Quote: ... a gift from Bob Weinberg. The cloning of the shRNAs in the pLKO.1 plasmid was performed as per the Addgene’s pLKO.1 cloning protocol ...
-
bioRxiv - Biophysics 2020Quote: ... Then 1 μl of EGFP Lifeact-7 plasmid (mEGFP-Lifeact-7 was a gift from Michael Davidson; Addgene plasmid # 54610), 100 μl Opti-MEM ([+] HEPES ...
-
bioRxiv - Cell Biology 2020Quote: ... and FLAG-tagged FL human TSC2 (1807 amino acids, UniProtKB/Swiss-Prot accession number P49815- 1) were purchased from Addgene, and pRK7 was subcloned with FLAG-tagged human TBC1D7 (293 amino acids ...
-
bioRxiv - Cell Biology 2020Quote: ... pWC223 encoding the motor domain of Drosophila kinesin 1 fused to BCCP (noted Kin1-biotin) was a gift from Jeff Gelles (Addgene plasmid # 15960 ...
-
bioRxiv - Neuroscience 2020Quote: All constructs containing the N/Q-rich region of the neuronal-specific Aplysia CPEB (residues 1-160) were cloned by PCR using a full-length clone (Addgene) as the template ...
-
bioRxiv - Immunology 2020Quote: A short-guide RNA targeting the BFL-1 transcriptional start site was cloned into the BsmbI-digested dCas9-KRAB-GFP (Addgene #71237, RRID: Addgene_71237) or lentiguide-puromycin (Addgene #52963 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Nsp1-NT (1-127 aa) and Nsp1-CT (128-180 aa) were amplified from pDONR207 SARS-CoV-2 NSP1 (Addgene) by PCR and then cloned into pDB-His-MBP or BacMam pCMV-Dest plasmid ...
-
bioRxiv - Molecular Biology 2021Quote: The knockdown plasmids for REST/NRSF and for the control GFP were constructed by ligating annealed primer pairs into the pLKO.1 vector (Addgene) between the EcoRI and AgeI sites ...
-
bioRxiv - Cell Biology 2021Quote: ... a single guide RNA targeting Pml exon 1 (Table 4) was subcloned into the pSpCas9 (BB)-2A-Puro plasmid (pX459v2, Addgene) and transfection of mESCs was performed using lipofectamine 3000 (Invitrogen ...
-
bioRxiv - Cancer Biology 2020Quote: ... were co-transfected with either mKO2-hCdt1(30/120)/pCSII-EF or mAG-hGeminin(1/110)/pCSII-EF) and 2nd generation viral packaging plasmids VSV.G (Addgene #14888) and psPAX2 (Addgene #12260) ...
-
Importin α/β Promote Kif18B Microtubule Association to Spatially Control Microtubule DestabilizationbioRxiv - Cell Biology 2022Quote: ... or pLOVE-EGFP-Kif18B-siRNAR-EBBD plasmids with 1 μmol each of the packaging plasmids dRT-pMDLg/pRRE (Addgene #60488), pRSV-Rev (Addgene #12253) ...
-
bioRxiv - Genomics 2022Quote: pNLZ11 (Pfib-1::NLS::scFv::sfGFP::NLS::tbb-2 3′UTR) construct has the pCFJ210 vector backbone (Addgene plasmid # 19329). A codon-optimized scFv::sfGFP fragment [42] was ordered from IDT ...
-
bioRxiv - Cell Biology 2022Quote: The sgRNA oligomers for SLC25A46 targeting exon 1 and 3 were annealed and inserted into plasmid pSpCas9(BB)-2A-Puro (PX459) V2.0 from Addgene (62988) via combined ligation (T7 ligase NEB).
-
bioRxiv - Genomics 2022Quote: cDNA encoding the short isoform of ETS-1 (p54) was cloned into pENTR vector and then into the destination vector MSCV-IRES-Thy1.1 DEST (Addgene: 17442) using Gateway cloning strategy (Gateway Clonase II ...
-
bioRxiv - Neuroscience 2022Quote: ... and AAV2-hSyn-mCherry (UNC vector core) (Figures 2, 6, & 7; Figure 2 – Figure supplement 1) or retrograde AAV-hSyn-DIO-eGFP (Addgene) and retrograde AAV-hSyn-mCherry (Addgene ...
-
bioRxiv - Molecular Biology 2022Quote: ... Virus was generated by plating 3.5×104 COS1 cells per well in a 6 well plate and transfecting them on the 2nd day with 1 ug total plasmid per well at a 5:3:2 ratio of lentiCRISPR:psPAX2(Addgene #12260):pMD2.G(Addgene#12259 ...
-
bioRxiv - Microbiology 2023Quote: ... and lentiviral particles expressing human TMPRSS2 (selection with 1 mg/ml G418). The TMPRSS2 (cat. 145843) and ACE2 (cat. 145839) lentiviral DNA clones (23) were purchased from Addgene and transfected into HEK293T cells together with pSPAX2 (Addgene ...
-
bioRxiv - Neuroscience 2022Quote: ... 800-1000 nL of a AAV5-hSyn-dLight1.2 vector (~1 × 1013 viral genomes/mL, obtained from Addgene; catalog #AAV5-111068) was delivered into the LNAc (antero-posterior ...
-
bioRxiv - Neuroscience 2022Quote: ... 6 mice from each line were injected bilaterally with a pAAV9-CAG-Flex.GCaMP6s.WPRE.SV40 virus (Addgene, titre ≥ 1×1013 vg/mL) in the medial NAc shell (D1-cre and D2(A2a)-cre mice ...
-
bioRxiv - Physiology 2022Quote: ... (Gagoski et al., 2016) or the rhodopsin-muscarinic receptor type 1 chimera (opto-M1R) (Morri et al., 2018) were purchased from Addgene (plasmids 67130 and 106069 respectively ...
-
bioRxiv - Physiology 2024Quote: cDNA of the canonical NR4A3 transcript (NR4A3-203; NM_006981.4) was synthesised into a modified pLenti CMV Puro DEST (w118-1) vector (Addgene plasmid #17452) by GENEWIZ (Azenta Life Science ...
-
bioRxiv - Molecular Biology 2024Quote: ... Annealing reactions were diluted 1:10 with water and then 1µL was used to ligate into 100ng of BsmBI digested pLentiGuidePuro vector (Addgene #52963) in 1x T4 DNA Ligase Buffer ...
-
bioRxiv - Neuroscience 2024Quote: ... rats received a bilateral prelimbic (PrL; AP: +2.8, ML: +/-0.6, DV: -3.8) infusion of AAV2.CamKII::hChR2(H134R)-EYFP (Addgene, titer: ∼1×1013) and a bilateral infusion of either AAV2.CMV::nNOS-shRNA-EGFP or AAV2.CMV::luciferase-shRNA-EGFP combined with an AAV2.hsyn::DIO-mCherry (Addgene ...
-
bioRxiv - Molecular Biology 2024Quote: ... Two gRNAs targeting Exon 1 (targeting sequence GGGCGCGCTACCTGTCTCCG) and Exon 10 (targeting sequence GAACTGGACTTTGAAAGAGG) were cloned in BPK1520 (Addgene #65777) and transfected with Amaxa Nucleofector II together with BPK4410 ...
-
bioRxiv - Cancer Biology 2024Quote: ... sgRNA oligonucleotides purchased from IDT were annealed and ligated in the BbsI restriction site of pX330A-1×2 (Addgene, #58766) plasmid to make pX330A-1x2-cNAT10 vector ...