Labshake search
Citations for Addgene :
2351 - 2355 of 2355 citations for 8 HYDROXY 2 METHYL 4 1H PYRAZOL 1 YL QUINOLINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: Cre-dependent recombinant adeno-associated virus (rAAV) expressing GCaMP7f under the control of the Synapsin promoter (rAAV1-Syn-FLEX-jGCaMP7f-WPRE-Sv40, Addgene #104492, titer: 1 × 1013 vg/mL) was used to express GCaMP7f in interneurons.
-
bioRxiv - Neuroscience 2024Quote: ... We injected in that region 3x750nL of an adeno-associated virus (AAV) mix of AAV1.Syn.GCaMP (6m: Addgene 100841 or 7f: Addgene 104488; dilution 1:10 ∼ 1x1013 GC/mL) and AAV1.Syn.Flex.Chrimson.tdTomato (UNC Vector Core ...
-
bioRxiv - Molecular Biology 2023Quote: The control vector pEGFP was generated by Gibson assembly 106 of the following DNA fragments: the EF-1 alpha promoter (amplified from pEF1a-mRor2WT, Addgene #2261, a gift from Roel Nusse 107) and the EGFP-ori-AmpR fragment (amplified from pCMV_ABEmax_P2A_GFP ...
-
bioRxiv - Cell Biology 2023Quote: ... U2OS cells expressing doxycycline (DOX)-activated DHFR-UBA5 were cotransfected with two plasmids: (1) pX330-U6-Chimeric BB-CBh-hSpCas9 (Addgene plasmid #42230, a gift from Feng Zhang), for expression of human codon-optimized SpCas9 and sgRNA UBA5 (ACCTACTATTGCTACGGCAA) ...
-
bioRxiv - Bioengineering 2023Quote: ... the neurons were transduced with 1 µL of an adeno-associated virus serotype 9 (AAV9) carrying a fluorescent calcium ion indicator GCaMP6s under a pan-neuronal human synapsin (hSyn) promoter (AAV9-hSyn::GCaMP6s, Addgene viral prep #100843-AAV9, >1×1013 IU/µL). After 5 days of incubation ...