Labshake search
Citations for Addgene :
2301 - 2350 of 2355 citations for 8 HYDROXY 2 METHYL 4 1H PYRAZOL 1 YL QUINOLINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: We also constructed pFGH1-UTG-mTagBFP2 as empty vectors by inserting PCR-amplified mTagBFP2 from pLKO.1 - TRC (a gift from Timothy Ryan; Addgene plasmid #191566) into digested backbone from pFGH1-UTG ...
-
bioRxiv - Cancer Biology 2023Quote: ... targeting exon 6 and exon 9 of human ATRX or mouse Atrx (Supplementary Table 1) were cloned into CRISPR-Cas9 lentiCRISPR v2 vector (gift from Feng Zhang, Addgene plasmid #52961). Lentivirus was produced in 293FT cells ...
-
bioRxiv - Bioengineering 2023Quote: ... The assembled fragment was sandwiched by two Smn1 intron 1 gRNA target sequence and subcloned into between ITRs of PX552 purchased from Addgene (Addgene 60958), and generated pAAV-SMN1-HITI ...
-
bioRxiv - Cell Biology 2023Quote: His-tagged Set9 protein expression was induced overnight at room temperature with 1 mM IPTG using BL21(DE3) Escherichia coli transformed with pET28 Set9 plasmid (Addgene plasmid #24082). Cells were pelleted at 7000 rpm for 20 minutes at 4°C using rotor JA-10 ...
-
bioRxiv - Cancer Biology 2022Quote: ... full-length ROS1 cDNA was cloned using the SalI and XhoI sites in the multiple cloning site of pENTR4-No ccDB (696-1) vector (Addgene Plasmid #17424) via In-Fusion™ cloning using PCR amplification that included the adition of C-terminal Flag tag ...
-
bioRxiv - Neuroscience 2023Quote: ... or left IC (0.9 mm caudal and 1 mm lateral from lambda suture) to inject 100-200 nL of pAAV-Syn-Chronos-GFP virus (Addgene #59170-AAV1). At the end of the surgery ...
-
bioRxiv - Neuroscience 2023Quote: ... 2.3 x 1013 vg/mL) or 200 nL/side AAV5-CMV-HI-eGFP-Cre-WPRE-SV4 (Addgene; ≥ 1 x 1013 vg/mL) was injected at a rate of 100 nL/min into the insula of Pdynlox/lox and Oprk1lox/lox mice ...
-
bioRxiv - Developmental Biology 2023Quote: ... The destination vector used in this study was pLenti CMV Neo DEST (705-1) (gift from Eric Campeau & Paul Kaufman; Addgene plasmid #17392). Once validated ...
-
bioRxiv - Developmental Biology 2023Quote: ... The cDNAs of mKif6 FL (1-803aa) and ML (360-803aa) were subcloned into pmCherry2-C1 vector (a gift from Michael Davidson, Addgene plasmid # 54563). mCherry was removed and mKif6 (1-493aa)-mNeonGreen was added into pmCherry2 vector ...
-
bioRxiv - Neuroscience 2023Quote: ... a 10-fold serial dilution in H20 was prepared of a commercially available bacterial plasmid (pBR322) containing the JCPyV Mad-1 full sequence (girt from Peter Howley, Addgene plasmid # 25626) [46] ...
-
bioRxiv - Cancer Biology 2023Quote: ... cloned into pLenti PGK Neo DEST (pLenti PGK Neo DEST (w531-1) a gift from Eric Campeau & Paul Kaufman (Addgene plasmid # 19067) by using the Gateway LR Clonase II Enzyme Mix (Invitrogen).
-
bioRxiv - Biochemistry 2023Quote: ... and the 6xHis-SUMO tag was removed by enzymatic cleavage using human Sentrin-specific protease 1 (SENP1) catalytic domain (derived from pET28a-HsSENP1, that was a gift from Jorge Eduardo Azevedo (Addgene plasmid #71465) at 4°C overnight27,28 ...
-
bioRxiv - Microbiology 2023Quote: The following plasmids were used in this study: pLenti CMV Blast DEST (706–1) (Ax203, a gift from Eric Campeau & Paul Kaufman, Addgene plasmid #17451); K8.1-OneStrep (OneStrep Tag ...
-
bioRxiv - Cancer Biology 2023Quote: ... For each microgram crude eccDNA we spiked in 1 ng pUC1932 (was a gift from Joachim Messing, Addgene plasmid # 50005; RRID: Addgene_50005) and 1 ng egfr fragment to generate crude circular DNA mixture.
-
bioRxiv - Cell Biology 2023Quote: ... two shRNAs targeting EZH2 (shEZH2-a: CCGGCCCAACATAGATGGACCAAATCTCGAGATTTGGTCCATCTATGTTGGGTTTTT G and shEZH2-b: CCGG CGGAAATCTTAAACCAAGAATCTCGAGATTCTTGGTTTAA GA TTTCCG TTTTTG) were designed and cloned into pLKO.1 vector (Addgene plasmid #10879) according to method by Moffat ...
-
bioRxiv - Neuroscience 2024Quote: Neurons were isolated by first virally labeling neurons from the same batch with pAAV-CAG-tdTomato for 24 hours (1:50 dilution, Addgene 59462-AAV1) prior to incorporation into miBrain or monoculture ...
-
bioRxiv - Neuroscience 2024Quote: ... 1) and inserted into sites of hSyn promoter in AAV-U6-sgRNA-hSyn-mCherry (a gift from Alex Hewitt, Addgene plasmid # 87916) (AAV-hMAG-mcherry) ...
-
bioRxiv - Cell Biology 2024Quote: ... The third generation HIV-1 derived lentiviral vector LeGO-iG2-Puro+-Luc2 expresses the Luc2 variant of firefly luciferase (cloned from AddGene Plasmid 24337) under the control of an SFFV-promoter ...
-
bioRxiv - Molecular Biology 2024Quote: ... with HA-tag at the N-terminal and GFP-tag at the C-terminal were cloned in pEGFP-N3 expression vector (Addgene #6080-1) (Table S8 ...
-
bioRxiv - Immunology 2024Quote: ... pcDNA3-sACE2(WT)-8his encoding soluble human ACE2 (UniProt Q9BYF1, residues 1-732) was a gift from Erik Procko (Addgene plasmid #149268) and was expressed and purified as described above for the other recombinant proteins.
-
bioRxiv - Molecular Biology 2024Quote: Mission plasmids encoding a control scrambled shRNA (Scr) and individual shRNA oligos against Pkm1 and Pkm2 (Supp. Table 1) were cloned in the pLKO_TRC001 vector (Addgene cat no. 10878) as previously described (54) ...
-
bioRxiv - Cell Biology 2024Quote: ... These were then assembled into a pLenti CMV V5-LUC Blast (w567-1) digested with BstXI (a gift from Eric Campeau (Addgene plasmid # 21474). Cy3 labeled collagen was prepared as previously described (Doyle ...
-
bioRxiv - Neuroscience 2024Quote: ... Gi DREADD virus (n=25,13 males, 12 females: AAV8-hSyn-DIO-hM4Di-mCherry,≥ 1×101 3 vg/mL, Addgene; Watertown, MA, USA) was mixed with GAD1-cre to express inhibitory designer receptors in VP GABA neurons ...
-
bioRxiv - Neuroscience 2024Quote: Cre-dependent recombinant adeno-associated virus (rAAV) for GCaMP7f (rAAV1-syn-FLEX-jGCaMP7f-WPRE, Addgene #1944820-AAV1, titer: ≥1:1013 vg/mL) were used to express GCaMP7f in the hippocampus of Vgat-Cre mice ...
-
bioRxiv - Biochemistry 2022Quote: ... The construct was packaged into lentivirus using HEK293T cells and delivered into target cells together with pLenti CMV rtTA3 Hygro (w785-1) (a gift from Eric Campeau Addgene plasmid no. 26730) for tetracycline inducible expression ...
-
bioRxiv - Biochemistry 2022Quote: ... These GFP positive cells were transduced with lentiviral particles for pLenti CMV rtTA3 Hygro (w785-1) (a gift from Eric Campeau Addgene plasmid number 26730) for tetracycline inducible expression and selected using hygromycin (200μg/ml) ...
-
bioRxiv - Cell Biology 2022Quote: ... and pLKO.6 sfCherry were generated from pLKO.1 puro plasmid (Addgene plasmid # 8453; http://n2t.net/addgene:8453; RRID:Addgene_8453; a gift from Bob Weinberg) (Stewart et al. ...
-
bioRxiv - Cancer Biology 2019Quote: CXCR4 shRNA Sequence: 5’CCGGTCCTGTCCTGCTATTGCATTACTCGAGTAATGCAATAGCAGGACAGGATTTTTG 3’ was cloned into the 3rd generation transfer plasmid pLKO.1 TRC cloning vector (Addgene cat no. 10878) between unique AgeI and EcoRI sites downstream of the U6 promoter ...
-
bioRxiv - Neuroscience 2020Quote: ... a pair of complementary 20 bp oligos for each guide RNA sequence was annealed and cloned into pX330 (Addgene 42230; for guide 1) or pSG (a shuttle vector ...
-
bioRxiv - Cell Biology 2022Quote: Dynamin-1-mCherry and dynamin-1(K44A)-mCherry were made by replacing the GFP from WT Dyn1 pEGFP and K44A Dyn1 pEGFP (Addgene #34680 and #34681), respectively ...
-
bioRxiv - Microbiology 2020Quote: ... was obtained through Addgene as a ready-to-use lentiviral pooled library at a titer ≥ 1×107 TU/mL (Addgene, cat. #73178-LV). To deliver the Brunello sgRNA library ...
-
bioRxiv - Developmental Biology 2019Quote: ... We amplified PCR fragments with the respective primers (see Table S1 for information about the gRNAs and Table S2 for primer sequences used) and 1 ng pCFD6 (Addgene, Cat. No: 73915) as template utilizing Q5 Hot Start High-Fidelity 2X Master Mix (New England Biolabs ...
-
bioRxiv - Cancer Biology 2020Quote: OE19-dCas9-KRAB stable cells were generated by transfecting 1×106 OE19 cells with 7.5 μg Cas9 plasmid with guides targeting the AAVS1 locus (Addgene #42230; 5’-GGGGCCACTAGGGACAGGAT-3’) and 7.5 μg donor plasmid (pAAVS1-Puro-DNR ...
-
bioRxiv - Developmental Biology 2021Quote: ... with the only exception of ΔR2 and ΔF_ALL_Inv that were generated by using a pair of sgRNA. The guide sequences (listed in Supp. Table 1) were then cloned in px459 CRISPR/Cas9 vector (Addgene Cat. N. 62988), previously digested with Bbs1 ...
-
bioRxiv - Immunology 2020Quote: A short-guide RNA targeting the BFL-1 transcriptional start site was cloned into the BsmbI-digested dCas9-KRAB-GFP (Addgene #71237, RRID: Addgene_71237) or lentiguide-puromycin (Addgene #52963 ...
-
bioRxiv - Neuroscience 2022Quote: ... Dual opsin-assisted circuit mapping and opto-tagging in brain slices: AAV2/-Syn-ChrimsonR-tdT (Addgene plasmid 59171, 1.3×1013 GC ml-1); AAV2/1-CAG-Flex-FlpO (made in house ...
-
bioRxiv - Neuroscience 2023Quote: ... Tetanus Neurotoxin Light Chain (TeLC) viruses were generated using AAV5-hSyn-FLEX-TeLC-P2A-dTomato (Addgene, 159102, 1 × 1013 genome copies per ml) at ISTA viral facility ...
-
bioRxiv - Neuroscience 2024Quote: The shRNA construct for mouse aldolase A was generated using oligos directed towards the 3’UTR of Aldoa (GCCCACTGCCAATAAACAACT) and control scrambled shRNA (CCGCAGGTATGCACGCGT) and cloned into the pLKO.1 cloning vector (Addgene Cat# 10878, RRID:Addgene_10878) and pCGLH vector for lentivirus and in utero electroporation experiments ...
-
bioRxiv - Molecular Biology 2024Quote: ... The synthetic sgRNA oligo pair complementary to exon 1 was designed and cloned into lentiCRISPRv2 vector (Addgene #52961, gift from Dr. Feng Zhang)143 following the published protocol.49 For virus production ...
-
bioRxiv - Neuroscience 2024Quote: ... All rats received bilateral microinjections of AAV2.CMV::nNOS-shRNA-EGFP or AAV2.CMV::luciferase-shRNA-EGFP (USC viral vector core: titer∼∼7×1013 vg/mL) combined with an AAV2.CAG::Flex-Ruby2sm-Flag.WPRE.SV40 (Addgene: titer: ∼1×1012 vg/ml) into the NAc ...
-
bioRxiv - Biophysics 2023Quote: The full-length α-synuclein monomer (1−140) expression plasmid (pET21a-alpha-synuclein) was a gift from Michael J Fox Foundation MJFF (Addgene plasmid # 51486). The α-synuclein monomer was expressed and purified following the previous method20,21 ...
-
bioRxiv - Neuroscience 2024Quote: ... sechellia nos-Cas9 (Auer et al., 2020) or co-injected with pHsp70-Cas9 (400 ng μl−1) (Addgene #45945; for D. simulans transgenesis) (Gratz et al. ...
-
bioRxiv - Genetics 2024Quote: We use two constructs for epigenome editing: 1) dCAS9-DNMT3A/3L co-expressed with enhanced green fluorescent protein (eGFP) for selection 12 (Addgene, Catalogue number 128424), and 2 ...
-
bioRxiv - Cell Biology 2019Quote: ... HEK293T cells were co-transfected using lentiviral packaging plasmids (psPAX2 and pMD2.G) with a PLKO.1-blast plasmid (Addgene, Cambridge, MA, USA, #26655) containing shSmad2 or shYAP ...
-
bioRxiv - Cancer Biology 2019Quote: ... H2B-RFP in pENTR1A (w507-1) and pENTR1A-GFP-N2 (FR1) were gifts from Eric Campeau and Paul Kaufman (Addgene plasmids # 22525 and # 19364). H2B-GFP plasmids were transduced using lentivirus infections.
-
bioRxiv - Cancer Biology 2022Quote: For CRISPR/Cas9 knockout AMPK sgRNA plasmids targeting exon 1 of AMPK α1 and αβ (pX462-hPRKAA1-gRNA, pX462-hPRKAA2-gRNA, #74374-74377) were purchased from Addgene (Watertown, MA, USA). LNT-229 ...
-
bioRxiv - Neuroscience 2022Quote: ... To chemogenetically activate PVNOT neurons by means of DREADD we employed AAV2/1-DIO-hSYN1-hM3Dq-mCherry (Addgene # 44361; titer: 1.6 × 1013 gc/ml) versus a respective control virus AAV2/1-DIO-hSYN1-mCherry (Addgene # 50459 ...
-
bioRxiv - Developmental Biology 2024Quote: In-frame integration of Dendra2 into the C-terminus of apoBb.1 was achieved using TALENs as previously described and validated (56) (Addgene stock 128695 and 128696). TALENs were in vitro transcribed using the T3 Message Machine Kit (Thermo Fisher Scientific ...
-
bioRxiv - Synthetic Biology 2019Quote: ... Sequence maps are included in File S2 and plasmids useful for constructing additional two-gene expression systems (pJS101 and pJS102, Table 1) are available from AddGene (deposit numbers 118280 and 118281) and have been verified by whole-plasmid sequencing [33].
-
bioRxiv - Biochemistry 2021Quote: ... the cells were transfected with 1 μg of mutant library and 100 μg of Bxb1 expressing plasmid (pCAG–NLS–HA–Bxb1; Addgene #51271, a gift from Pawel Pelczar) in triplicate ...