Labshake search
Citations for Addgene :
2051 - 2071 of 2071 citations for 6 6 dimethyl 1 phenyl 6 7 dihydro 1H indazol 4 5H one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... The synthetic sgRNA oligo pair complementary to exon 1 was designed and cloned into lentiCRISPRv2 vector (Addgene #52961, gift from Dr. Feng Zhang)143 following the published protocol.49 For virus production ...
-
bioRxiv - Biophysics 2023Quote: The full-length α-synuclein monomer (1−140) expression plasmid (pET21a-alpha-synuclein) was a gift from Michael J Fox Foundation MJFF (Addgene plasmid # 51486). The α-synuclein monomer was expressed and purified following the previous method20,21 ...
-
bioRxiv - Cell Biology 2023Quote: ... and EBP50-PDZ12 (aa 1-298) cloned into the pCMV-2-FLAG vector were gifts from Maria-Magdalena Georgescu (Addgene plasmids #28291-28297).
-
bioRxiv - Neuroscience 2024Quote: ... sechellia nos-Cas9 (Auer et al., 2020) or co-injected with pHsp70-Cas9 (400 ng μl−1) (Addgene #45945; for D. simulans transgenesis) (Gratz et al. ...
-
bioRxiv - Genetics 2024Quote: We use two constructs for epigenome editing: 1) dCAS9-DNMT3A/3L co-expressed with enhanced green fluorescent protein (eGFP) for selection 12 (Addgene, Catalogue number 128424), and 2 ...
-
bioRxiv - Cell Biology 2019Quote: ... HEK293T cells were co-transfected using lentiviral packaging plasmids (psPAX2 and pMD2.G) with a PLKO.1-blast plasmid (Addgene, Cambridge, MA, USA, #26655) containing shSmad2 or shYAP ...
-
bioRxiv - Cancer Biology 2019Quote: ... H2B-RFP in pENTR1A (w507-1) and pENTR1A-GFP-N2 (FR1) were gifts from Eric Campeau and Paul Kaufman (Addgene plasmids # 22525 and # 19364). H2B-GFP plasmids were transduced using lentivirus infections.
-
bioRxiv - Cancer Biology 2022Quote: For CRISPR/Cas9 knockout AMPK sgRNA plasmids targeting exon 1 of AMPK α1 and αβ (pX462-hPRKAA1-gRNA, pX462-hPRKAA2-gRNA, #74374-74377) were purchased from Addgene (Watertown, MA, USA). LNT-229 ...
-
bioRxiv - Cancer Biology 2022Quote: 293T cells were transfected with packaging plasmids (8 μg of pCMV-dR8.2 dVPR and 1 μg pCMV-VSV-G, a gift from Robert Weinberg, Addgene plasmid #8455 and 8454, respectively) along with shRNA plasmids (8 μg ...
-
bioRxiv - Neuroscience 2022Quote: ... To chemogenetically activate PVNOT neurons by means of DREADD we employed AAV2/1-DIO-hSYN1-hM3Dq-mCherry (Addgene # 44361; titer: 1.6 × 1013 gc/ml) versus a respective control virus AAV2/1-DIO-hSYN1-mCherry (Addgene # 50459 ...
-
bioRxiv - Developmental Biology 2024Quote: In-frame integration of Dendra2 into the C-terminus of apoBb.1 was achieved using TALENs as previously described and validated (56) (Addgene stock 128695 and 128696). TALENs were in vitro transcribed using the T3 Message Machine Kit (Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2022Quote: ... the modules in these plasmids (split Cas9, MCP, sgRNA cassette) were PCR-amplified and recloned into 2 lentiviral plasmids (pLKO.1 neo, Addgene #13425; pLJM-EGFP, Addgene #19319) and ...
-
bioRxiv - Cell Biology 2019Quote: ... CDC45: guide#1 GCATCAGGGTCGGGCTCTGA and guide#2 GCTCTGTCCTCCCTCAACGG) were inserted into pX335-U6-Chimeric_BB-CBh-hSpCas9n(D10A) (Addgene plasmid #42335, a gift from Feng Zhang) via BbsI restriction site ...
-
bioRxiv - Synthetic Biology 2019Quote: ... Sequence maps are included in File S2 and plasmids useful for constructing additional two-gene expression systems (pJS101 and pJS102, Table 1) are available from AddGene (deposit numbers 118280 and 118281) and have been verified by whole-plasmid sequencing [33].
-
bioRxiv - Neuroscience 2023Quote: 750 nl of rAAV.EF1a.DIO.hChR2(H134R).eYFP or rAAV.EF1a.DIO.eYFP (3-4 x 10^12 vg/ml, AAV5, University of North Carolina Vector Core; 1-2 x 10^13 vg/ml, AAV1, Addgene, 27056-AAV1 and 20298-AAV1) were injected into each hemisphere of the VTA of 3–4-month-old DAT-Cre mice ...
-
bioRxiv - Biochemistry 2021Quote: ... the cells were transfected with 1 μg of mutant library and 100 μg of Bxb1 expressing plasmid (pCAG–NLS–HA–Bxb1; Addgene #51271, a gift from Pawel Pelczar) in triplicate ...
-
bioRxiv - Neuroscience 2023Quote: Cre-dependent recombinant adeno-associated virus (rAAV) expressing GCaMP7f under the control of the Synapsin promoter (rAAV1-Syn-FLEX-jGCaMP7f-WPRE-Sv40, Addgene #104492, titer: 1 × 1013 vg/mL) was used to express GCaMP7f in interneurons.
-
bioRxiv - Neuroscience 2024Quote: ... We injected in that region 3x750nL of an adeno-associated virus (AAV) mix of AAV1.Syn.GCaMP (6m: Addgene 100841 or 7f: Addgene 104488; dilution 1:10 ∼ 1x1013 GC/mL) and AAV1.Syn.Flex.Chrimson.tdTomato (UNC Vector Core ...
-
bioRxiv - Molecular Biology 2023Quote: The control vector pEGFP was generated by Gibson assembly 106 of the following DNA fragments: the EF-1 alpha promoter (amplified from pEF1a-mRor2WT, Addgene #2261, a gift from Roel Nusse 107) and the EGFP-ori-AmpR fragment (amplified from pCMV_ABEmax_P2A_GFP ...
-
bioRxiv - Cell Biology 2023Quote: ... U2OS cells expressing doxycycline (DOX)-activated DHFR-UBA5 were cotransfected with two plasmids: (1) pX330-U6-Chimeric BB-CBh-hSpCas9 (Addgene plasmid #42230, a gift from Feng Zhang), for expression of human codon-optimized SpCas9 and sgRNA UBA5 (ACCTACTATTGCTACGGCAA) ...
-
bioRxiv - Bioengineering 2023Quote: ... the neurons were transduced with 1 µL of an adeno-associated virus serotype 9 (AAV9) carrying a fluorescent calcium ion indicator GCaMP6s under a pan-neuronal human synapsin (hSyn) promoter (AAV9-hSyn::GCaMP6s, Addgene viral prep #100843-AAV9, >1×1013 IU/µL). After 5 days of incubation ...