Labshake search
Citations for Addgene :
2001 - 2050 of 2071 citations for 6 6 dimethyl 1 phenyl 6 7 dihydro 1H indazol 4 5H one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... packaged at UPenn Vector Core 2.5 × 1014 GC ml−1] and KORD [AAV8-HSyn-DIO-HA-KORD-IRES-mCitrine (Addgene plasmid no. 65417), packaged at UPenn Vector Core ...
-
bioRxiv - Immunology 2024Quote: ... Production of lentiviral particles was performed by transient co-transfection (polyethylenimine:DNA at 3.5:1 ratio) of HEK 293T cells with the second-generation packaging system plasmid psPAX2 and pMD2.G (Addgene, 12260 and 12259). Viral supernatants were harvested at 48h post-transfection ...
-
bioRxiv - Neuroscience 2023Quote: Calcium indicator expression in vLGN/IGL neurons was achieved with AAV-hSynapsin1- FLEx-axon-GCaMP6s (1 × 1012 genome copies per ml, Addgene, 112010-AAV5) for retinal expression AAV2.7M8-syn-GCaMP8m viral vectors (1 × 1013 genome copies per ml) ...
-
bioRxiv - Cell Biology 2023Quote: ... two shRNAs targeting EZH2 (shEZH2-a: CCGGCCCAACATAGATGGACCAAATCTCGAGATTTGGTCCATCTATGTTGGGTTTTT G and shEZH2-b: CCGG CGGAAATCTTAAACCAAGAATCTCGAGATTCTTGGTTTAA GA TTTCCG TTTTTG) were designed and cloned into pLKO.1 vector (Addgene plasmid #10879) according to method by Moffat ...
-
bioRxiv - Cancer Biology 2022Quote: ... full-length ROS1 cDNA was cloned using the SalI and XhoI sites in the multiple cloning site of pENTR4-No ccDB (696-1) vector (Addgene Plasmid #17424) via In-Fusion™ cloning using PCR amplification that included the adition of C-terminal Flag tag ...
-
bioRxiv - Cancer Biology 2023Quote: ... targeting exon 6 and exon 9 of human ATRX or mouse Atrx (Supplementary Table 1) were cloned into CRISPR-Cas9 lentiCRISPR v2 vector (gift from Feng Zhang, Addgene plasmid #52961). Lentivirus was produced in 293FT cells ...
-
bioRxiv - Bioengineering 2023Quote: ... The assembled fragment was sandwiched by two Smn1 intron 1 gRNA target sequence and subcloned into between ITRs of PX552 purchased from Addgene (Addgene 60958), and generated pAAV-SMN1-HITI ...
-
bioRxiv - Cell Biology 2023Quote: His-tagged Set9 protein expression was induced overnight at room temperature with 1 mM IPTG using BL21(DE3) Escherichia coli transformed with pET28 Set9 plasmid (Addgene plasmid #24082). Cells were pelleted at 7000 rpm for 20 minutes at 4°C using rotor JA-10 ...
-
bioRxiv - Biochemistry 2023Quote: ... and the 6xHis-SUMO tag was removed by enzymatic cleavage using human Sentrin-specific protease 1 (SENP1) catalytic domain (derived from pET28a-HsSENP1, that was a gift from Jorge Eduardo Azevedo (Addgene plasmid #71465) at 4°C overnight27,28 ...
-
bioRxiv - Cancer Biology 2023Quote: ... cloned into pLenti PGK Neo DEST (pLenti PGK Neo DEST (w531-1) a gift from Eric Campeau & Paul Kaufman (Addgene plasmid # 19067) by using the Gateway LR Clonase II Enzyme Mix (Invitrogen).
-
bioRxiv - Microbiology 2023Quote: The following plasmids were used in this study: pLenti CMV Blast DEST (706–1) (Ax203, a gift from Eric Campeau & Paul Kaufman, Addgene plasmid #17451); K8.1-OneStrep (OneStrep Tag ...
-
bioRxiv - Neuroscience 2023Quote: ... or left IC (0.9 mm caudal and 1 mm lateral from lambda suture) to inject 100-200 nL of pAAV-Syn-Chronos-GFP virus (Addgene #59170-AAV1). At the end of the surgery ...
-
bioRxiv - Neuroscience 2023Quote: ... 2.3 x 1013 vg/mL) or 200 nL/side AAV5-CMV-HI-eGFP-Cre-WPRE-SV4 (Addgene; ≥ 1 x 1013 vg/mL) was injected at a rate of 100 nL/min into the insula of Pdynlox/lox and Oprk1lox/lox mice ...
-
bioRxiv - Cell Biology 2023Quote: Two small gRNA (#1-GGGGTATTTCAATCAGAAGC; #2-ACGGGAAGCGCACAGTTTAT) targeting msps genomic region were synthesized and inserted into the pCFD5 vector (74) (Addgene, Plasmid #73914) via BbsI digestion ...
-
bioRxiv - Developmental Biology 2023Quote: ... The destination vector used in this study was pLenti CMV Neo DEST (705-1) (gift from Eric Campeau & Paul Kaufman; Addgene plasmid #17392). Once validated ...
-
bioRxiv - Developmental Biology 2023Quote: ... The cDNAs of mKif6 FL (1-803aa) and ML (360-803aa) were subcloned into pmCherry2-C1 vector (a gift from Michael Davidson, Addgene plasmid # 54563). mCherry was removed and mKif6 (1-493aa)-mNeonGreen was added into pmCherry2 vector ...
-
bioRxiv - Neuroscience 2023Quote: ... a 10-fold serial dilution in H20 was prepared of a commercially available bacterial plasmid (pBR322) containing the JCPyV Mad-1 full sequence (girt from Peter Howley, Addgene plasmid # 25626) [46] ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV9-EF1a-DIO-hChR2-EYFP (1:2, Addgene viral prep # 20298- AAV9; http://n2t.net.addgene:20298; RRID; Addgene:20298, gift from Karl Deisseroth); Fig 4 ...
-
bioRxiv - Neuroscience 2023Quote: ... Pipettes were front-filled with AAV (serotype 2/1) expressing either CAG-FLEX-GFP (UPenn, lot# V0827) or pCAG-FLEX-tdTomato-WPRE (Addgene cat# 51503). 3 min after reaching the target ...
-
bioRxiv - Cancer Biology 2023Quote: ... For each microgram crude eccDNA we spiked in 1 ng pUC1932 (was a gift from Joachim Messing, Addgene plasmid # 50005; RRID: Addgene_50005) and 1 ng egfr fragment to generate crude circular DNA mixture.
-
bioRxiv - Biochemistry 2023Quote: ... and inserted into two model DARPins: 1) 3G124 (anti-GFP) and 2) and Off7 (anti-MBP) and cloned into a pET vector (Addgene plasmid #29666) containing a N-terminal His-Tag ...
-
bioRxiv - Biochemistry 2024Quote: We also constructed pFGH1-UTG-mTagBFP2 as empty vectors by inserting PCR-amplified mTagBFP2 from pLKO.1 - TRC (a gift from Timothy Ryan; Addgene plasmid #191566) into digested backbone from pFGH1-UTG ...
-
bioRxiv - Cancer Biology 2023Quote: ... and SNAI1 knockdown cells were generated by cloning respective shRNA sequences into the 3rd generation lentiviral plasmid pLKO.1 TRC cloning vector (Addgene, cat# 10878) between unique AgeI and EcoRI sites downstream of the U6 promoter ...
-
bioRxiv - Cell Biology 2024Quote: ... These were then assembled into a pLenti CMV V5-LUC Blast (w567-1) digested with BstXI (a gift from Eric Campeau (Addgene plasmid # 21474). Cy3 labeled collagen was prepared as previously described (Doyle ...
-
bioRxiv - Cell Biology 2024Quote: ... The third generation HIV-1 derived lentiviral vector LeGO-iG2-Puro+-Luc2 expresses the Luc2 variant of firefly luciferase (cloned from AddGene Plasmid 24337) under the control of an SFFV-promoter ...
-
bioRxiv - Neuroscience 2024Quote: Neurons were isolated by first virally labeling neurons from the same batch with pAAV-CAG-tdTomato for 24 hours (1:50 dilution, Addgene 59462-AAV1) prior to incorporation into miBrain or monoculture ...
-
bioRxiv - Molecular Biology 2024Quote: ... with HA-tag at the N-terminal and GFP-tag at the C-terminal were cloned in pEGFP-N3 expression vector (Addgene #6080-1) (Table S8 ...
-
bioRxiv - Neuroscience 2024Quote: ... 1) and inserted into sites of hSyn promoter in AAV-U6-sgRNA-hSyn-mCherry (a gift from Alex Hewitt, Addgene plasmid # 87916) (AAV-hMAG-mcherry) ...
-
bioRxiv - Molecular Biology 2024Quote: Mission plasmids encoding a control scrambled shRNA (Scr) and individual shRNA oligos against Pkm1 and Pkm2 (Supp. Table 1) were cloned in the pLKO_TRC001 vector (Addgene cat no. 10878) as previously described (54) ...
-
bioRxiv - Immunology 2024Quote: ... pcDNA3-sACE2(WT)-8his encoding soluble human ACE2 (UniProt Q9BYF1, residues 1-732) was a gift from Erik Procko (Addgene plasmid #149268) and was expressed and purified as described above for the other recombinant proteins.
-
bioRxiv - Neuroscience 2024Quote: ... Gi DREADD virus (n=25,13 males, 12 females: AAV8-hSyn-DIO-hM4Di-mCherry,≥ 1×101 3 vg/mL, Addgene; Watertown, MA, USA) was mixed with GAD1-cre to express inhibitory designer receptors in VP GABA neurons ...
-
bioRxiv - Neuroscience 2024Quote: Cre-dependent recombinant adeno-associated virus (rAAV) for GCaMP7f (rAAV1-syn-FLEX-jGCaMP7f-WPRE, Addgene #1944820-AAV1, titer: ≥1:1013 vg/mL) were used to express GCaMP7f in the hippocampus of Vgat-Cre mice ...
-
bioRxiv - Biochemistry 2022Quote: ... The construct was packaged into lentivirus using HEK293T cells and delivered into target cells together with pLenti CMV rtTA3 Hygro (w785-1) (a gift from Eric Campeau Addgene plasmid no. 26730) for tetracycline inducible expression ...
-
bioRxiv - Biochemistry 2022Quote: ... These GFP positive cells were transduced with lentiviral particles for pLenti CMV rtTA3 Hygro (w785-1) (a gift from Eric Campeau Addgene plasmid number 26730) for tetracycline inducible expression and selected using hygromycin (200μg/ml) ...
-
bioRxiv - Genomics 2019Quote: ... We co-transfected the pLentiRNACRISPR constructs together with a GFP expression plasmid in a 2:1 molar ratio. The guide RNA length comparison (Supplementary Fig. 1d) was done using previously published RfxCas13d constructs (Addgene 109049 and 109053), except that we removed the GFP cassette from the RfxCas13d plasmid ...
-
bioRxiv - Cancer Biology 2019Quote: CXCR4 shRNA Sequence: 5’CCGGTCCTGTCCTGCTATTGCATTACTCGAGTAATGCAATAGCAGGACAGGATTTTTG 3’ was cloned into the 3rd generation transfer plasmid pLKO.1 TRC cloning vector (Addgene cat no. 10878) between unique AgeI and EcoRI sites downstream of the U6 promoter ...
-
bioRxiv - Cell Biology 2020Quote: ... SKO cells were transfected with pSH-EFIRES-P-GFP(1-10)opti AAVS1 Safe Harbor integration plasmid (Addgene plasmid # 129416, [35] and pCas9-sgAAVS1-2 (Addgene plasmid # 129727 [47]), and a stable pool was selected using puromycin (1 µg/ml puromycin for 6 days ...
-
bioRxiv - Neuroscience 2021Quote: stGtACR2: 300 nL 1:10 AAV2/8-hSyn1-SIO-stGtACR2-FusionRed (working concentration 4.7*1011 gc/mL, Addgene/Janelia Viral Core, Ashburn, VA)
-
bioRxiv - Neuroscience 2020Quote: Stereotaxic injection of AAV-EF1a-DIO-HChR2(H134R)-eYFP (serotype 2/1 or 2/9, U. Penn Vector Core, Philadelphia, PA, USA or Addgene, Watertown, MA, USA) was performed in 6-8 weeks old DAT-IRES-Cre or FoxP2-Cre transgenic mice ...
-
bioRxiv - Neuroscience 2020Quote: ... a pair of complementary 20 bp oligos for each guide RNA sequence was annealed and cloned into pX330 (Addgene 42230; for guide 1) or pSG (a shuttle vector ...
-
bioRxiv - Cell Biology 2022Quote: Dynamin-1-mCherry and dynamin-1(K44A)-mCherry were made by replacing the GFP from WT Dyn1 pEGFP and K44A Dyn1 pEGFP (Addgene #34680 and #34681), respectively ...
-
bioRxiv - Microbiology 2020Quote: ... was obtained through Addgene as a ready-to-use lentiviral pooled library at a titer ≥ 1×107 TU/mL (Addgene, cat. #73178-LV). To deliver the Brunello sgRNA library ...
-
bioRxiv - Developmental Biology 2019Quote: ... We amplified PCR fragments with the respective primers (see Table S1 for information about the gRNAs and Table S2 for primer sequences used) and 1 ng pCFD6 (Addgene, Cat. No: 73915) as template utilizing Q5 Hot Start High-Fidelity 2X Master Mix (New England Biolabs ...
-
bioRxiv - Cancer Biology 2020Quote: OE19-dCas9-KRAB stable cells were generated by transfecting 1×106 OE19 cells with 7.5 μg Cas9 plasmid with guides targeting the AAVS1 locus (Addgene #42230; 5’-GGGGCCACTAGGGACAGGAT-3’) and 7.5 μg donor plasmid (pAAVS1-Puro-DNR ...
-
bioRxiv - Developmental Biology 2021Quote: ... with the only exception of ΔR2 and ΔF_ALL_Inv that were generated by using a pair of sgRNA. The guide sequences (listed in Supp. Table 1) were then cloned in px459 CRISPR/Cas9 vector (Addgene Cat. N. 62988), previously digested with Bbs1 ...
-
bioRxiv - Immunology 2020Quote: A short-guide RNA targeting the BFL-1 transcriptional start site was cloned into the BsmbI-digested dCas9-KRAB-GFP (Addgene #71237, RRID: Addgene_71237) or lentiguide-puromycin (Addgene #52963 ...
-
bioRxiv - Neuroscience 2022Quote: ... Dual opsin-assisted circuit mapping and opto-tagging in brain slices: AAV2/-Syn-ChrimsonR-tdT (Addgene plasmid 59171, 1.3×1013 GC ml-1); AAV2/1-CAG-Flex-FlpO (made in house ...
-
bioRxiv - Neuroscience 2024Quote: The shRNA construct for mouse aldolase A was generated using oligos directed towards the 3’UTR of Aldoa (GCCCACTGCCAATAAACAACT) and control scrambled shRNA (CCGCAGGTATGCACGCGT) and cloned into the pLKO.1 cloning vector (Addgene Cat# 10878, RRID:Addgene_10878) and pCGLH vector for lentivirus and in utero electroporation experiments ...
-
bioRxiv - Neuroscience 2023Quote: ... Tetanus Neurotoxin Light Chain (TeLC) viruses were generated using AAV5-hSyn-FLEX-TeLC-P2A-dTomato (Addgene, 159102, 1 × 1013 genome copies per ml) at ISTA viral facility ...
-
bioRxiv - Neuroscience 2024Quote: ... Wild-type animals were then injected whether with mix 1 or mix 2 or AAV9-CamKII-GCaMP6f-WPRE-SV40 (Addgene, 100834, vg/mL) or AAV9-CamKII-hM4D(Gi)-mCherry (construct provided by Bryan Roth ...