Labshake search
Citations for Addgene :
151 - 200 of 2513 citations for Rat Nuclear Factor Of Activated T Cells 5 NFAT5 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... the complementary DNA (cDNA) for each iMN factor (Ngn2, Lhx3, Isl1, NeuroD1, Ascl1, Brn2 and Myt1l) was purchased from Addgene and cloned into the pMXs retroviral expression vector using Gateway cloning technology (Invitrogen) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... A human elongation factor 1 (EF1) promoter was introduced using a Gateway att4-att1 Entry clone (Addgene, Watertown, MA, #162920). Final expression clones were verified by restriction analysis and maxiprep DNA was prepared using the Qiaprep Maxiprep kit (Qiagen ...
-
bioRxiv - Molecular Biology 2023Quote: Constructs for shRNA targeting Primpol (5’- ATTTAGCCGACACCTAATATT) Smarcal1 (5’- CTGATTCAAGAGAAGATTAAA) and Smug1 (5’- AACTATGTGACTCGCTACT) were designed and inserted into pLKO.1neo plasmid (Addgene #13425). Lentiviruses were generated using a standard protocol (Feng and Jasin ...
-
bioRxiv - Cell Biology 2023Quote: ... pT7-EGFP-C1-HsDCP1a was a gift from Elisa Izaurralde (Addgene plasmid # 25030; http://n2t.net/addgene:25030;RRID:Addgene_25030) (Tritschler et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... The 5-HT1eR and 5-HT1FR PRESTO-Tango constructs were obtained from Addgene. For transfection ...
-
bioRxiv - Biophysics 2021Quote: ... The pET MBP His6 LIC cloning vector (2Cc-T) was a gift from Scott Gradia (Addgene plasmid # 37237 ...
-
bioRxiv - Biophysics 2022Quote: ... pET His6 GST TEV LIC cloning vector (2G-T) was a gift from Scott Gradia (Addgene plasmid # 29707 ...
-
bioRxiv - Biochemistry 2023Quote: ... The human Archease gene spanning residues 27-168 was inserted into the 2M-T (Addgene: 29708) plasmid using ligation-independent cloning (LIC) ...
-
bioRxiv - Biochemistry 2023Quote: Two vectors with C-terminal MBP (maltose-binding protein)-His6 Tag (2Cc-T; Addgene Plasmid #55209) or N-terminal His10-MBP Tag (2CT-10 ...
-
bioRxiv - Biophysics 2023Quote: ... coli expression vectors encoding either no tag (UC Berkeley Macrolab vector 2A-T, Addgene ID 29665) or an N-terminal TEV protease-cleavable His6-tag (UC Berkeley Macrolab vector 2B-T ...
-
bioRxiv - Molecular Biology 2024Quote: ... reporter cell lines were generated by TALEN-mediated homology-directed repair to integrate enhancer reporter donor constructs into the AAVS1 locus by electroporation of 1 × 106 K562 cells (or K562 cells selected to have the desired synthetic transcription factor) with 1 ng of reporter donor plasmid and 0.5 ng of each TALEN-L (Addgene no. 35431) and TALEN-R (Addgene no ...
-
bioRxiv - Neuroscience 2021Quote: Rats underwent stereotaxic surgery to inject either an excitatory (AAV8.hSyn.hM3Dq.mCherry; Addgene, catalog # 50474-AAV8) or inhibitory (AAV8.hSyn.hM4Di.mCherry ...
-
bioRxiv - Cell Biology 2023Quote: ... and the DAG maker C1δ-GFP amplified from rat PKCδ C1-containing plasmid (Addgene #21216) 61 was expressed from ura4 locus under scs2 promoter ...
-
bioRxiv - Neuroscience 2019Quote: ... forward primer-5’-AGCAGCACGACTTCTTCAAGTCC and reverse primer 5’-TGTAGTTGTACTCCAGCTTGTGC (modified protocol from Addgene, USA). A known concentration (2 × 109 molecules/µl ...
-
bioRxiv - Cell Biology 2020Quote: ... 5′-CAAACAATCAGCAATGCCTG-3′ and 5′-TGAAGTATTCAGAACAGAAG-3′ and cloned into pX330-P2A-EGFP (Addgene) through ligation using T4 ligase (New England Biolabs) ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 μg pVSV (#138479, Addgene), 8 μg psPAX2 (#12260 ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV2/5 (Addgene Plasmid #104964), and pHelper (Cell Biolab ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 µg pRSV-Rev (Addgene 12253 ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 μg p8.9NdeltaSB (Addgene #132929) and 0.5 μg pCMV-VSV-G (Addgene #8454) ...
-
bioRxiv - Cell Biology 2019Quote: ... Addgene Plasmid 44842 (pFA6a-link-yoTagRFP-T-SpHis5) was a gift from Wendell Lim & Kurt Thorn (Addgene plasmid # 44842 ...
-
bioRxiv - Genomics 2021Quote: ... Early passage primary MEFs were transformed with SV-40 T antigen containing plasmid pBSSVD2005 (ADDGENE, Cambridge, MA) to generate immortalized MEFs ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... coding for the large T oncogene SV40 (V40 1: pBSSVD2005 was a gift from David Ron; Addgene plasmid #21826 ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV-GFP was a gift from John T Gray (Addgene plasmid # 32395 ; http://n2t.net/addgene:32395 ; RRID:Addgene_32395). List of antibodies is presented in Table S1.
-
bioRxiv - Synthetic Biology 2024Quote: ... Genes encoding natural transcription factors were sourced from: cJun (pCLXSN-c-JUN, which was a gift from Jin Chen, Addgene plasmid #102758)36 and BATF (pFUW-TetO-BATF ...
-
bioRxiv - Developmental Biology 2022Quote: ... The empty ctrl or MMP14-eGFP lentiviral plasmid (7.5 μg) was co-transfected into 293 cells with packaging plasmid pRSV-Rev (5 μg, Addgene #12253), pMDLg/pRRE (2.5 μg ...
-
bioRxiv - Microbiology 2020Quote: The integrins subunits were overexpressed in CHO cells line with the following plasmids: Alpha 5 integrin-GFP (Addgene plasmid# 15238)50 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The AND gate constructs were optimized by making constructs with ribosome binding site library (5’-GAAAGANNNGANNNACTA-3’) in front of regulators in chemically competent Marionette Clo cells prepared from Addgene [40] ...
-
bioRxiv - Genetics 2024Quote: HeLa CRISPRi cells were generated by lentiviral integration (∼3 to 5 MOI) using the dCas9-KRAB-blast plasmid (Addgene #89567), followed by single cell isolation ...
-
bioRxiv - Biochemistry 2022Quote: ... and rat TRPM8 were amplified by PCR and subcloned into p3xFLAG-eYFP-CMV-7.1 vector (Addgene) at the NotI/BamHI sites or into 8xHis-MBP pFastBac1 modified with a CMV promoter (obtained from David Julius’ lab ...
-
Linear ubiquitination at damaged lysosomes induces local NF-κB activation and controls cell survivalbioRxiv - Cell Biology 2023Quote: ... GFP as non-human target (NHT) control (5’-GGAGCGCACCATCTTCTTCA-3’, 5’-GCCACAAGTTCAGCGTGTC-3’, and 5’-GGGCGAGGAGCTGTTCACCG-3’) cloned into pLentiCRISPRv2 (Addgene, 52961, deposited by Feng Zhang). To generate lentiviral particles ...
-
bioRxiv - Molecular Biology 2020Quote: ... At least two independent sets of oligonucleotide pairs for gene knockdown of human MTs and the transcription factor MTF-1 (supplementary table S4) were synthesized and cloned into the pLKO.1-TCR vector (Addgene, Cambridge, MA, USA); the same vector was also used as an empty vector control ...
-
bioRxiv - Cell Biology 2023Quote: ... fibroblasts were reprogrammed using lentiviral vectors that carried six transcription factors (ADDGENE/PSIN4-EF2-N2L, ADDGENE/PSIN4-EF2-O2S and ADDGENE/PSIN4-CMV-K2M). Fibroblast cells were plated in 6-well plates at 1.5 x 105 cells per well (Day 0) ...
-
bioRxiv - Cell Biology 2019Quote: ... Addgene Plasmid 44842 (pFA6a-link-yoTagRFP-T-SpHis5) was a gift from Wendell Lim & Kurt Thorn (Addgene plasmid # 44842; http://n2t.net/addgene:44842; RRID:Addgene_44842).
-
bioRxiv - Microbiology 2019Quote: ... They were immortalized by transduction with a retroviral vector encoding SV40 large T antigen (pBABE-zeo largeTcDNA, Addgene). The Atf6+/+ vs ...
-
bioRxiv - Biophysics 2022Quote: ... pET His6 LIC cloning vector (2Bc-T) was a gift from Scott Gradia (Addgene plasmid # 37236; http://n2t.net/addgene:37236; RRID:Addgene_37236). 2A-protease in 2Bc-T plasmid was expressed as described for the 2G-T-plasmid expressed proteins ...
-
bioRxiv - Biophysics 2022Quote: ... pET His6 GST TEV LIC cloning vector (2G-T) was a gift from Scott Gradia (Addgene plasmid # 29707; http://n2t.net/addgene:29707; RRID:Addgene_29707). Single ...
-
bioRxiv - Cell Biology 2019Quote: ... Primary MEFs were then immortalized by transient transfection with a plasmid expressing SV40 large T antigen (Addgene #21826). Single cell clones were then isolated by limiting dilution ...
-
bioRxiv - Biochemistry 2022Quote: Human SERPINE1 cDNA was subcloned from pAY-FE-PAI-1 using ligation independent cloning into the pET Flag TEV LIC cloning vector (2L-T, a gift from Scott Gradia—Addgene plasmid #29175; http://n2t.net/addgene:29715; RRID:Addgene_29715) using primers pET PAI-1 LIC For and pET PAI-1 LIC Rev (SI Table 1 ...
-
bioRxiv - Cell Biology 2023Quote: ... mTagRFP-T-Clathrin-15 was a gift from Michael Davidson (Addgene plasmid # 58005; http://n2t.net/addgene:58005; RRID:Addgene_58005) (Shaner et al ...
-
bioRxiv - Neuroscience 2023Quote: ... Polycistronic CRISPR plasmids pX33075 and pX45876 were optimized so that one vector contained two U6 promotors with two sgRNA sequences.39 Guide RNA sequences were chosen as described.77,78 The DNA sequence encoding the TagRFP-T_A1aY1 Tyr-T sensor was amplified from Addgene plasmid #158751 (a gift from Minhajuddin Sirajuddin43 ...
-
bioRxiv - Biophysics 2023Quote: ... or an N-terminal TEV protease-cleavable His6-tag (UC Berkeley Macrolab vector 2B-T, Addgene ID 29666). For coexpression ...
-
bioRxiv - Cell Biology 2021Quote: ... and AAV packaging plasmid expressing Rep2/Cap5 genes for production of serotype 5 – pAAV2/5 (RRID:Addgene_104964).
-
bioRxiv - Neuroscience 2024Quote: ... we obtained the AAV2/5 virus of the GFAP -tdTomato vector from Addgene (#44332-AAV2/5). Titers ranged from 1-4 x 1013 vg/mL.
-
bioRxiv - Developmental Biology 2022Quote: ... Lentiviruses delivering sgRNA were packed by transfecting about 70% confluent HEK293T cells cultured in T75 flasks with 5 µg pCMV-VSVG (Addgene 8454), 10 µg pCMV-dR8.2 dvpr (Addgene 8455) ...
-
bioRxiv - Cell Biology 2021Quote: ... and 1.5 million cells were resuspended in Mirus nucleofector solution and electroporated with 5 ug of px458 plasmid (Addgene plasmid #48138) containing a small guide RNA (see Table S1 for oligonucleotide information ...
-
bioRxiv - Neuroscience 2020Quote: ... cells were transfected with a combination of three plasmids: 5 μg of pMD2.G (gift from Didier Trono, Addgene plasmids #12259), 15 μg of psPAX2 (gift from Didier Trono ...
-
bioRxiv - Microbiology 2020Quote: ... Plasmids were then linearized with MluI and 2μg of plasmid was transfected into 5×105 HEK293 cells together with a plasmid encoding the T7 polymerase 63 (Addgene 65974) using calcium phosphate ...
-
bioRxiv - Cell Biology 2022Quote: ... 5 x 104 MDCK II cells were transiently transfected with pSpCas9(BB)-2A-Puro (PX459) plasmids (Addgene, plasmid #62988, MA, USA) (Ran et al. ...
-
bioRxiv - Microbiology 2023Quote: ... lentiviral particles pseudotyped with the VSV-G protein were produced by cotransfecting HEK293T cells in 10cm dishes with 5 mg pLentiCMVPuroDEST vector (Addgene, #17452), 2 mg VSV-G Env expression vector pMD2.G (Addgene #12259 ...
-
bioRxiv - Plant Biology 2022Quote: ... pICH41402 (Addgene #50285; ΩTMV 5’UTR), pAGM47523 (Addgene #153221 ...