Labshake search
Citations for Addgene :
1 - 50 of 2513 citations for Rat Nuclear Factor Of Activated T Cells 5 NFAT5 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... We first cloned the N- and C-termini of NFAT5 isoform A synthetized by Addgene into a pMSGV retroviral vector ...
-
bioRxiv - Cell Biology 2020Quote: ... Jurkat T cells were transfected with mTurquoise-Farnesyl-5 plasmid (#55551, Addgene) 24 hours prior to the assay ...
-
bioRxiv - Genomics 2021Quote: ... cells were transfected with 6ug nuclear-localized GFP construct (Addgene #67652) using Fugene HD transfection reagent (Promega) ...
-
bioRxiv - Cell Biology 2021Quote: Embryonic fibroblasts were generated from RHBDL4 WT and RHBDL4 KO E14.5 embryos and immortalized using lentiviral transduction of SV40 virus large T antigen (Ef1a_Large T-antigen_Ires_Puro, Addgene plasmid 18922), as described by Christova et al ...
-
bioRxiv - Bioengineering 2022Quote: ... The T-cell factor/lymphoid enhancer factor (TCF/LEF) luciferase reporter SuperTopFlash (STF) and the control pRL-SV40 Renilla luciferase constructs (Addgene) were used for Wnt/β-catenin-responsive reporter assays ...
-
bioRxiv - Systems Biology 2022Quote: ... The nuclear-localized mCherry was digested from pBRY-nuclear mCherry-IRES-PURO (Addgene plasmid 52409) and the ~860bp band was gel purified ...
-
bioRxiv - Neuroscience 2021Quote: HEK293T cells were transfected with an inducible nuclear-localized HT protein (HT-NLS, Addgene #82518). Doxycycline (DOX ...
-
bioRxiv - Bioengineering 2024Quote: ... H2B-iRFP nuclear marker was (Addgene Plasmid #90237). ELP48 was obtained from Addgene (Addgene Plasmid #68395) ...
-
bioRxiv - Neuroscience 2020Quote: ... In this plasmid the DIO-GFP sequence was replaced by C1V1(t/t)-TS-mCherry from the rAAV CaMKIIa-C1V1(t/t)-TS-mCherry (Addgene, plasmid #35500).
-
bioRxiv - Neuroscience 2023Quote: ... in VTA of TH-Cre rats (N=5) or simultaneously expressing AAV9-rTH-PI-Cre (AddGene #107788 ...
-
bioRxiv - Cell Biology 2021Quote: Measurement of NFAT4 nuclear translocation in HEK293 cells was achieved by transient overexpression of NFAT4-GFP (Addgene #21664) as previously described(30 ...
-
bioRxiv - Cell Biology 2024Quote: ... The T-REx293 cell line was transiently transfected with LentiCRISPRv2 (Addgene, #52961). The sgRNA sequences used for cloning LentiCRISPRv2-DHHC5 were ...
-
bioRxiv - Systems Biology 2019Quote: MCF10A cells were transduced with nuclear RFP-expressing lentivirus (LV-RFP, a gift from Elaine Fuchs, Addgene plasmid #26001) and treated under conditions listed in Table 1 ...
-
bioRxiv - Biophysics 2020Quote: ... and EBFP2-Nucleus-7 (nuclear localization signal, Addgene, plasmid #55249), using GenJet transfection reagent (Signagen) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... the human codon-optimized Cas9 coding sequence including two nuclear localization signals (SV40 NLS at the 5’ and nucleoplasmin NLS at the 3’) was amplified from hCas9 (Addgene #41815; http://n2t.net/addgene:41815) using primers F_Cas9 and R_Cas9 ...
-
bioRxiv - Neuroscience 2020Quote: ... or 400nl of AAV9-CaMKIIa.C1V1(t/t).TS.EYFP (≥1013 CG/ml, Addgene). Orexin promoter virus expression specificity has been characterized previously (González et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... TagRFP-T (Addgene #122200) or iRFP670 (Addgene # 122182 ...
-
bioRxiv - Cancer Biology 2019Quote: ... the HFF-1 cells were lentivirally transduced with GFP-H2B nuclear marker using the PGK-H2BeGFP system as described by Addgene and selected by flow sorting for GFP positive cells.
-
bioRxiv - Molecular Biology 2021Quote: ... 40 million cells per replicate were activated and 12-20 h later electroporated with the pSpCas9(BB)-2A-GFP plasmid (pX458; Addgene 48138) expressing the Myc sgRNA using the MaxCyte STx transfection system (MaxCyte) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Single clones were obtained by fluorescence-activated cell sorting and functionally tested for Cas9 activity using a lentiviral reporter pKLV2-U6gRNA5(gGFP)-PGKBFP2AGFP-W (Addgene #67980). PPM1D-mutant cell lines were generated using the RNP-based CRISPR/Cas9 delivery method using a single sgRNA (GCTAAAGCCCTGACTTTA) ...
-
Comprehensive fitness landscape of SARS-CoV-2 Mpro reveals insights into viral resistance mechanismsbioRxiv - Molecular Biology 2022Quote: ... The LexA_ER_B112 transcription factor was amplified from Addgene_58437 (FRP880_PACT1(−1-520)-LexA-ER-haB112-TCYC1 was a gift from Joerg Stelling ...
-
bioRxiv - Physiology 2023Quote: ... Rat cacna2d1 (RRID: Addgene_26575) and cacna1a were gifts from D ...
-
bioRxiv - Cancer Biology 2019Quote: ... immortalized MEFs (transduced with large T and small T expressing lentivirus (Plasmid #22298, Addgene) were transduced with an H2B-Neon expressing lentivirus (pLV-H2B-Neon-ires-Puromycin)74,75 ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV-CamKIIa-C1V1(t/t)-mScarlet-KV2.1 was a gift from Christopher Harvey (Addgene viral prep # 124650-AAV9 ...
-
bioRxiv - Biochemistry 2022Quote: ... 2G-T (Addgene plasmid #29707), 2GFP-T (Addgene plasmid #29716) ...
-
bioRxiv - Biochemistry 2022Quote: ... 2GFP-T (Addgene plasmid #29716), and co-transformation vector 13S-A (Addgene plasmid 48323) ...
-
bioRxiv - Cell Biology 2021Quote: ... 5’CACCGTGCAGCCCCCATAGCAGGTG and 5’AAACCACCTGCTATGGGGGCTGCAC) were synthesized by ID&T (Leuven, Belgium) and cloned into the pSpCas9(BB)-2A-Puro plasmid (pXP459, Addgene #48139). HeLa cells were co-transfected with the two RNF213-targeting plasmids with Lipofectamine 3000 (L3000008 ...
-
bioRxiv - Developmental Biology 2020Quote: ... MCP-TagRFPT constructs were assembled by replacing the eGFP fragment of pNosPE_MCP-eGFP using NheI/BamHI with the TagRFPT coding sequence amplified by PCR (supplementary table 1) from TagRFP-T-Rabenosyn-5 (Addgene 37537). MCP-TagRFPT-NLS was generated by insertion of the TagRFPT-NLS coding sequence into pNosPE_MCP-eGFP with NEBuilder® HiFi DNA Assembly Master Mix (primers listed in supplementary table 1).
-
bioRxiv - Neuroscience 2023Quote: ... Oertner) or AAV2/1-EF1a-DIO-iChloC-2A-dsRed (5×1013 GC/ml; Addgene plasmid #70762, a gift from T. Margrie). For calcium imaging experiments ...
-
bioRxiv - Cell Biology 2019Quote: HeLa cells were transfected with GFP-ITSN2-S and TagRFP-T-EEA1 (Addgene, reference: 42635) and observed under spinning disk microscope (Zeiss Axio Observer Z1 with a Yokogawa CSU X1 confocal head ...
-
bioRxiv - Neuroscience 2024Quote: ... two 5 weeks old rats habituated to tickling underwent unilateral injection of 100 nl at 30 nl/min of AAV2/5.hsyn.eGFP (Addgene, 50465-AAV5) in the insular cortex at the following coordinates ...
-
bioRxiv - Cell Biology 2023Quote: ... Rat Myo1b (Plasmid #135064, Addgene) C-terminal Myc-tag ...
-
bioRxiv - Biophysics 2023Quote: Dendra-2 EEA1 was generated by replacing TagRFP-T in RagRFP-T EEA1 (Addgene plasmid #42635) at cloning sites AgeI and XhoI ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were transduced by thermosensitive retroviral gene transfer of SV40 T antigen (LOX-CW-CRE, Addgene) at a MOI of 5 in Proliferation UREC medium with 8μg/mL polybrene (64) ...
-
bioRxiv - Immunology 2023Quote: ... mouse naïve CD4+ T cells were transfected with p8xEGFP-N1 (Addgene # 122168, gift from Georg Mayr) which expresses 8 concatemeric EGFP proteins ...
-
bioRxiv - Cell Biology 2020Quote: ... EEA1 TagRFP-T (Addgene plasmid #42635), a gift from Silvia Corvera ...
-
bioRxiv - Neuroscience 2019Quote: ... The AAV packaging plasmid encoding a nuclear envelope-embedded eGFP reporter (Addgene 131682) was constructed by amplifying the KASH domain from (Addgene 60231 ...
-
bioRxiv - Molecular Biology 2024Quote: A pET28b plasmid encoding C-terminal 6xHis-tagged nuclear Pif1 (Addgene plasmid #65047)64 was employed to express and purify Pif1 from E ...
-
bioRxiv - Neuroscience 2023Quote: ... we injected AAV9-CaMKIIa.C1V1(t/t).TS.EYFP (titer: 2.3 × 1013 GC/ml; prepared by Addgene, MA, USA) into the unilateral dorsal hippocampus as described previously 87.
-
bioRxiv - Cell Biology 2020Quote: ... pLKO plasmids were co-transfected into HEK293-T cells along with packaging plasmids pMDLg/pRRE (Addgene #12251), pRSV-Rev (Addgene #12253 ...
-
bioRxiv - Immunology 2023Quote: Mouse naïve CD4+ T cells were transfected with C1-MPAct-mCherry (Addgene #155222, gift from Tobias Meyer) and C1-eGFP-CaaX (Addgene #86056 ...
-
bioRxiv - Cell Biology 2023Quote: ... rat OTC (from Addgene plasmid #71877) was cloned into the lentiviral backbone pLV-EF1a-IRES-Hygro (Addgene plasmid #85134) ...
-
bioRxiv - Biochemistry 2021Quote: ... SV40 T antigen lentiviral plasmid (Addgene #22298) was packaged in HEK 293T cells using helper plasmids pMD2.G (Addgene #12259 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... hsp68lacZ (gift from T. Capellini, Addgene #37843). The light haplotype sequence file and hsp68lacZ vector were provided to Taconic Biosciences (NY ...
-
bioRxiv - Developmental Biology 2019Quote: ... was a gift from Elisa Izaurralde (Addgene plasmid # 37370) (78) ...
-
bioRxiv - Biochemistry 2021Quote: ... CRISPR Jurkat T cells were generated by stably expressing with lentiviral particles pLX-311-Cas9 construct (Addgene 96924) and transiently transfecting with Amaxa® Cell Line Nucleofector® Kit T (Ref ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were immortalized by transduction with a retrovirus expressing SV40 large T antigen from pBABE-puro largeTcDNA (Addgene plasmid # 14088 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and SV40-T/t antigens expressing lentiviruses using vectors pLenti CMV-RasV12-Neo (w108-1) (HRAS G12V, #22259, Addgene), and pLenti-CMV/TO-SV40 small + Large T (w612-1 ...
-
bioRxiv - Neuroscience 2022Quote: ... Addgene) designer receptors exclusively activated by designer drugs (DREADD) or control (pAAV8-hSyn-EGFP; Addgene) were delivered into the dLS as described for GCaMP7 (see 2.4.1 ...
-
bioRxiv - Plant Biology 2021Quote: ... IPT3 promoter was cloned in frame with a nuclear localization signal (Addgene, catalog number: 50294), tdTOMATO CDS ...