Labshake search
Citations for Addgene :
151 - 200 of 366 citations for N Acetyl Tizanidine d4 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... Constructs encoding the DFCP1 N-terminus were cloned into pET-His6-MBP-TEV-LIC (Addgene # 29708) and Rosetta2(DE3 ...
-
bioRxiv - Biochemistry 2022Quote: FUS SYQG LC containing a TEV cleavable N-terminal histidine tag (RP1B FUS LC, AddGene #127192), full-length FUS with an N-terminal histidine tag and maltose-binding protein fusion (pTHMT FUS 1-526 ...
-
bioRxiv - Cell Biology 2022Quote: ... MAC (BirA-Ha-Strep-tag II)-N was a gift from Markku Varjosalo (Addgene plasmid # 108078). FLAG-tagged TR-TUBE has been previously published (Yoshida et al. ...
-
bioRxiv - Genomics 2021Quote: ... vectors by replacing the Cas9 and puromycin N-acetyltransferase sequences in lentiCRISPR v2 plasmid (Addgene, 52961) with hygromycin B phosphotransferase and EGFP or mCherry sequences ...
-
bioRxiv - Biophysics 2021Quote: ... coli expression vector with an N-terminal 6xHis tag followed by an MBP tag (Addgene #29654) by ligation independent cloning (LIC) ...
-
bioRxiv - Cell Biology 2022Quote: Human PFKFB3 tagged with N-terminal GFP was cloned into the viral plasmid pWPXL (Addgene #12257). A PFKFB3 mutant (nuc-free PFKFB3 ...
-
bioRxiv - Cell Biology 2024Quote: ... For N-terminal tagging a repair donor plasmid consisting of mCherry2 (derived from Addgene plasmid # 72831), flanked by a total of 6X Flag repeat epitope tags was generated ...
-
bioRxiv - Neuroscience 2023Quote: ... Entry vectors were transferred into pDEST-CMV-N-EGFP (24) (Prof. Robin Ketteler, AddGene clone 122842) and/or pdcDNA-FlagMyc (B ...
-
The Hippo pathway terminal effector TAZ/WWTR1 mediates oxaliplatin sensitivity in colon cancer cellsbioRxiv - Cancer Biology 2023Quote: Murine Taz was expressed by transfecting cells with pEF-TAZ-N-Flag from Michael Yaffe (Addgene #19025 ...
-
bioRxiv - Genetics 2023Quote: ... Various Npu intein-split ABE constructs were cloned into N- and C-terminal AAV vectors (Addgene plasmids 137177 and 137178 ...
-
bioRxiv - Neuroscience 2023Quote: ... in VTA of TH-Cre rats (N=5) or simultaneously expressing AAV9-rTH-PI-Cre (AddGene #107788 ...
-
bioRxiv - Neuroscience 2023Quote: ... or GFP and Synaptophysin-RFP cDNA (pRVdG-N-P-M-EGFP-SynPhRFP-L, Addgene plasmid #52483), and with these additional plasmids ...
-
bioRxiv - Biochemistry 2021Quote: ... GST-tag and MBP-tag were attached to its N- and C-terminus respectively (Addgene ID 169195). The cleavage at G//A resulted in 25 and 42 kDa products ...
-
bioRxiv - Cancer Biology 2020Quote: Plasmid 821 pGEX2T PTEN 1-274 (N-PTEN) was a gift from William Sellers (Addgene plasmid # 10741) (Ramaswamy et al. ...
-
bioRxiv - Biochemistry 2021Quote: ... P1-8 and Photobacterium damselae were cloned into pNIC28-Bsa4 (N-terminal polyhistidine tag; Addgene #26103 (60)) ...
-
bioRxiv - Biophysics 2022Quote: ... Rat CaMKIIWT with an N-terminal EGFP pCAG-mEGFP-CaMKIIa was a gift from Ryohei Yasuda (Addgene plasmid # 127389 ...
-
bioRxiv - Cell Biology 2022Quote: ... The GFP-VASP (mEmerald-VASP-N-10) plasmid was a gift from Michael Davidson (Addgene plasmid 54297). The GFP-RIAM(1-666 ...
-
bioRxiv - Microbiology 2023Quote: ... the puromycin N-acetyltransferase (PAC) gene was amplified from pLenti CMV Puro DEST (w118-1) (Addgene #17452) by PCR ...
-
bioRxiv - Cell Biology 2024Quote: ... CAPS-FLAG was created by Gateway cloning the CAPS gene into pDEST-N-terminal FLAG (Addgene #18700), providing expression of N-terminally FLAG-tagged CAPS control of the cmv-promoter ...
-
bioRxiv - Cell Biology 2023Quote: ... Cloning of Def16 sequence to pET plasmid containing an N-terminus Hisx6 tag and GFP (Addgene # 29663) was done by whole plasmid amplification using the indicated forward and reverse primers for GFP-Def16 (primers 1 and 2 ...
-
bioRxiv - Biochemistry 2022Quote: AR-LBD (663-919) containing an N-terminal His-tag and encoded in pET15b plasmid (Addgene #89083) was expressed in Rosetta (DE3 ...
-
bioRxiv - Cell Biology 2023Quote: cDNA sequences encoding N- and C-terminal fragments of Venus were amplified from pCe-BiFC-VN173 (Addgene) and pCe-BiFC-VC155 (Addgene ...
-
bioRxiv - Microbiology 2023Quote: ... Plasmids encoding HCoV-229E and SARS-CoV-2 N proteins were obtained from Addgene (#151912 and #141391). C-terminally FLAG-tagged 229E N and SARS-CoV-2 N constructs were cloned into pcDNA3.1 using specific primer sequences (Supplementary Table S1).
-
bioRxiv - Cancer Biology 2022Quote: ... Digested gBlocks were ligated to digested pGEX-6p1-N-HA (gift from Andrew Jackson & Martin Reijns, Addgene plasmid # 119756 ...
-
bioRxiv - Plant Biology 2024Quote: ... Arabidopsis thaliana DJ-1C (without N-terminal signal sequence) and DJ-1E were cloned into pRS415 (Addgene) using BamHI and SalI sites under GPD (Glyceraldehyde -3-phosphate dehydrogenase ...
-
bioRxiv - Biophysics 2020Quote: ... The plasmid MApple-LC-Myosin-N-7 was a gift from Michael Davidson (Addgene plasmid # 54920; http://n2t.net/addgene:54920; RRID:Addgene_54920). The plasmid MCherry-Actin-C-18 was a gift from Michael Davidson (Addgene plasmid # 54967 ...
-
bioRxiv - Molecular Biology 2019Quote: ... mCherry-SiT-N-15 plasmid was a gift from Michael Davidson (Addgene plasmid # 55133; http://n2t.net/addgene:55133;RRID:Addgene_55133). mCherry tagged GalT was generated from Cerulean-GalT plasmid by replacing cerulean to mCherry using subcloning technology ...
-
bioRxiv - Synthetic Biology 2021Quote: ... the mEmerald tag was PCR amplified from mEmerald-PLK1-N-16 vector (Addgene #54234; http://n2t.net/addgene:54234 ; RRID:Addgene_54234), while pEN435 - pCAGGS-TagBFP-hGeminin-2A-mCherry-hCdt1- rbgpA-Frt-PGK-EM7-PuroR-bpA-Frt Tigre targeting (Addgene #9213925 ...
-
bioRxiv - Cell Biology 2021Quote: ... The resulting PCR product was inserted into pLVpuro-CMV-N-EGFP (Addgene plasmid # 122848 ; http://n2t.net/addgene:122848; RRID:Addgene_122848) (94 ...
-
bioRxiv - Cell Biology 2021Quote: ... Gateway recombination of the destination vector pLVpuro-CMV-N-APEX2-EGFP with the entry clone pDONR223 LC3B WT (Addgene plasmid # 123072; http://n2t.net/addgene:123072; RRID:Addgene_123072) (94 ...
-
bioRxiv - Cell Biology 2021Quote: The Rho1 ORF (DGRC LD03419) was cloned into pGEX6P1-N-HA (Andrew Jackson and Martin Reijns, Addgene 119756).
-
bioRxiv - Biochemistry 2020Quote: ... cDNA encoding wild-type human ubiquitin containing an N-terminal HA-tag was expressed from pRK5-HA (Addgene). Full-length EGFP fused N-terminally to a nuclear localization signal (NLS ...
-
bioRxiv - Immunology 2022Quote: ... The MSCV-N EBNA3A plasmid used as a backbone for PCR was a gift from Karl Munger (Addgene plasmid # 37956 ...
-
bioRxiv - Cell Biology 2019Quote: ... EGFP-vinculin head (residue 1-258) and the N-terminal fusion of vinculin-T12 were obtained from Addgene (#46270 ...
-
bioRxiv - Neuroscience 2021Quote: ... mEos3.2-Homer1-N-18 was a gift from Michael Davidson (Addgene plasmid # 57461 ; http://n2t.net/addgene:57461; RRID:Addgene_57461). CMV::SypHy A4 was a gift from Leon Lagnado (Addgene plasmid # 24478 ...
-
bioRxiv - Cancer Biology 2020Quote: Expression plasmid encoding N-terminally Flag-tagged hFOXO1-3A (#13508) was purchased from Addgene (Cambridge, MA, pCDNA3 backbone). FOXO1-3A has Ala residue substitutions at Thr-24 ...
-
bioRxiv - Molecular Biology 2023Quote: ... before using LR reaction to transfer the cDNA into destination vectors pLEX_305-C-dTAG or pLEX_305-N-dTAG (Addgene #91797 & #91798 ...
-
bioRxiv - Molecular Biology 2023Quote: ... To tag endogenous POLQ at the N-terminus with a 3xFLAG-LoxP-SV40-Puro-Lox-HaloTag (Addgene #86843), ∼ 5 × 105 U2OS cells were transfected using FuGene6 (Promega ...
-
bioRxiv - Cell Biology 2024Quote: ... pcDNA3-N-HA-NEK7 and pcDNA3-N-HA-NEK7K64M were gifts from Bruce Beutler (Addgene plasmid # 75142 ; http://n2t.net/addgene:75142 ; RRID:Addgene_75142) and (Addgene plasmid # 75143 ...
-
bioRxiv - Cell Biology 2023Quote: ... HeLa cells were co-transfected with pcDNA3.0 plasmids containing human CDC50A (NM_018247, N-terminal FLAG tag; RRID: Addgene_203694) and ATP10B variants (O94823.2 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Digested gBlocks were ligated to digested pGEX-6p1-N-HA (gift from Andrew Jackson & Martin Reijns, Addgene plasmid # 119756; http://n2t.net/addgene:119756; RRID:Addgene_119756). BL21 (DE3 ...
-
bioRxiv - Molecular Biology 2023Quote: ... pLVpuro-CMV-N-EGFP was a gift from Robin Ketteler (Addgene plasmid # 122848; http://n2t.net/addgene:122848 ; RRID:Addgene_122848). pSpCas9(BB)-2A-Puro (PX459 ...
-
bioRxiv - Cell Biology 2023Quote: ... The plasmid for STIM1-mApple was prepared in our lab as described previously123 and that for mEmerald-TOMM20-N-10 was a gift from Michael Davidson (http://n2t.net/addgene:54282 ; RRID:Addgene_54282).
-
bioRxiv - Developmental Biology 2023Quote: ... The full-length RUVBL1 with N-terminal 3×FLAG tag (pCDNA-3xFLAG-Pontin) was obtained from Addgene (51635). All cell lines were grown in DMEM (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2022Quote: ... The constructs were LR-recombined into pDest-pcDNA3.1 with N-terminal FLAG-tag or into pLIX_403 (Plasmid #41395, Addgene) with C-terminal GFP-tag ...
-
bioRxiv - Microbiology 2024Quote: ... N/Tert-1 Cas9 knockout cells were generated by transduction with a spCas9 lentiviral expression vector (Addgene # 52962) and selecting with blasticidin ...
-
bioRxiv - Biochemistry 2023Quote: ... pDEST-CMV-N-EGFP was a gift from Robin Ketteler (Addgene plasmid # 122842; http://n2t.net/addgene:122842; RRID:Addgene_122842) (78).
-
bioRxiv - Biophysics 2023Quote: ... or an N-terminal TEV protease-cleavable His6-tag (UC Berkeley Macrolab vector 2B-T, Addgene ID 29666). For coexpression ...
-
bioRxiv - Plant Biology 2024Quote: ... AtDJ-1C (without N-terminal signal sequence) and AtDJ-1E were cloned into a pRSF-duet vector (Addgene) for protein purification by using primers P5-P8 (Table 1).
-
bioRxiv - Cell Biology 2019Quote: ... The donor plasmid to insert mEGFP into the N-terminus of lamin B1 was purchased from Addgene (Cat# 87422). TrueCut Cas9 protein v2 and TrueGuide 1-piece modified synthetic gRNA (GGGGTCGCAGTCGCCATGGC ...