Labshake search
Citations for Addgene :
51 - 100 of 366 citations for N Acetyl Tizanidine d4 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... N-terminal His6 plus glutathione S-transferase (GST; RRID:Addgene_29707); N-terminal His6 plus small ubiquitin-like modifier (SUMO ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV5-CAG- Dlight1.1 (n = 1 Area X hemisphere; Addgene). During the same surgery ...
-
bioRxiv - Microbiology 2023Quote: ... were subcloned into pLVpuro-CMV-N-3xFLAG (Addgene #123223) by Gateway cloning ...
-
bioRxiv - Cell Biology 2023Quote: ... mVenus-Integrin-Beta1-N-18 plasmid (Addgene plasmid #56330) was obtained from Addgene (USA) ...
-
bioRxiv - Bioengineering 2023Quote: ... n×GCN4 sequences were derived from plasmid (Addgene #113022) via PCR ...
-
Striated muscle-specific base editing enables correction of mutations causing dilated cardiomyopathybioRxiv - Genetics 2022Quote: ... we used Cbh_v5 AAV-ABE N-terminal (Addgene: 137177) and Cbh_v5 AAV-ABE C-terminal (Addgene ...
-
bioRxiv - Neuroscience 2019Quote: ... promoter-driven AAV with mCitrine (n=44; U North Carolina vector core: AAV2-hSyn-HA-hM4D(Gi)-IRES-mCitrine) or mCherry (n=16; Addgene: AAV2-hSyn-hM4D(Gi)-mCherry ...
-
bioRxiv - Cell Biology 2021Quote: ... pGEX6P1-N-HA (Andrew Jackson and Martin Reijns, Addgene 119756) was utilized as the backbone for recombinant protein expression E ...
-
bioRxiv - Cancer Biology 2020Quote: ... N-WASP (#54199) and fascin (#54094) were obtained from Addgene. Each insert was cloned into the lentiviral plasmid pCDH-CMV-MCS-EF1-Puro with GFP fusion protein at C-terminus.
-
bioRxiv - Neuroscience 2020Quote: ... excitatory Gq DREADD (AAV8-hSyn-hM3Gq-mCherry; Addgene; n = 10); and control construct (AAV5-hSyn-EYFP ...
-
bioRxiv - Microbiology 2022Quote: ... derived from a pcDNA3.1-hACE2 vector (Cat. n° 145033, Addgene), was inserted into a pLenti6.3 vector (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2020Quote: ... Fyn was amplified from mEos2-FYN2-N-10 (Addgene 57380) and assembled into pBlueScript with either a mec-4 or osm-10 promoter and the unc-54 3’UTR using the NEBuilder HiFi DNA Assembly kit ...
-
bioRxiv - Biochemistry 2021Quote: ... or N-terminal His6 plus green fluorescent protein (GFP; RRID:Addgene_29716). Note that in the plasmid names for this clone the numbering of Syx residues was based on the Syx isoform from NCBI Reference Sequence NP_001036128.1 ...
-
bioRxiv - Biochemistry 2021Quote: ... N-terminal His6 plus small ubiquitin-like modifier (SUMO; RRID:Addgene_29711); or N-terminal His6 plus green fluorescent protein (GFP ...
-
bioRxiv - Genetics 2023Quote: ... for CTCF and mEmerald-RAD21-N-18 (Addgene Plasmid #54248) for RAD21 ...
-
bioRxiv - Molecular Biology 2023Quote: ... H-RASV12 from pBABE-Puro H-RASV12 (n°12545 Addgene) was cloned in a home-made inducible vector derived from pLVX-Tight-Puro (Clontech ...
-
bioRxiv - Immunology 2023Quote: ... N-MLV reporter viruses were generated by transfection of a three-plasmid system: pCIG3-N for expression N-MLV gag/pol (Addgene #132941, a gift from Jeremy Luban) [50] ...
-
bioRxiv - Biophysics 2020Quote: ... containing N-terminal 6-His-WT-p53 (1-303) (Addgene, 24859), was used to express p53 ...
-
bioRxiv - Immunology 2021Quote: ... or 2C-T (AmpR, N-terminal His6-MBP fusion; Addgene #29706). Plasmids were transformed into E ...
-
bioRxiv - Neuroscience 2020Quote: ... full name AAV-EF1a-DIO-trkB.DN-TM570-mCherry (Addgene, n°121502), was constructed by PCR amplification of rat truncated trkB.T1 with the sequence downstream of the transmembrane domain replaced by the sequence of three alanine residues followed by a stop codon (from the plasmid pLTM570 ...
-
bioRxiv - Microbiology 2021Quote: ... a pHAGE N-mNeonGreen IRES puro was also generated (Addgene #170467).
-
bioRxiv - Cell Biology 2022Quote: ... N-terminal IBAR genes were cloned into Cry2PHR-mCherry (Addgene #26866) using NheI and XhoI restriction sites (Kennedy et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... pZac2.1-hSynapsin1::NAPA-N SV40 (gift from Baljit Khakh, Addgene #92282) (titer ...
-
bioRxiv - Neuroscience 2021Quote: ... mEos3.2-Homer1-N-18 was a gift from Michael Davidson (Addgene plasmid # 57461 ...
-
bioRxiv - Biophysics 2022Quote: ... pCMV-mApple-MyosinIIA-N-18 (Addgene #54930, gift from Michael Davidson), and pEGFP internal GFP Ezrin (gift from Florence Niedergang).
-
bioRxiv - Cell Biology 2020Quote: ... and mCherry-Cx43-N-7 were gifts from Michael Davidson (Addgene plasmids # 55112 ...
-
bioRxiv - Physiology 2020Quote: ... the mouse N-Shh sequence was then cloned in pRRLsin.MND.MCS.WPRE (Addgene) that had been previously digested by NheI and PmlI ...
-
bioRxiv - Biophysics 2022Quote: ... pCMV-mCherry-FilaminA-N-9 (Addgene #55047, gift from Michael Davidson), pCMV-mEmerald-Alpha-Actinin-19 (Addgene #53989 ...
-
bioRxiv - Cell Biology 2022Quote: ... construct was cloned into a pLVpuro-CMV-N-EGFP (Addgene, #122848) lentivirus plasmid using the gateway system (ATTB sites were added at the Paxillin-peGFP plasmid using the primers ...
-
bioRxiv - Molecular Biology 2023Quote: N-terminal histidine tagged wild-type VCP was obtained from Addgene (plasmid #12373 ...
-
bioRxiv - Molecular Biology 2023Quote: ... pLVpuro-CMV-N-EGFP was a gift from Robin Ketteler (Addgene plasmid # 122848 ...
-
bioRxiv - Biochemistry 2023Quote: ... or N-terminal His10-MBP Tag (2CT-10; Addgene Plasmid #37237) were chosen as the MBP tag has been shown to increase the solubility of select proteins [9] ...
-
bioRxiv - Cell Biology 2023Quote: ... Ad-mApple-TOMM20 derived from mApple-TOMM20-N-10 (Addgene #54955), Ad-EGFP-BNIP3 ...
-
bioRxiv - Cancer Biology 2023Quote: ... we initially electroporated with a pCAGGS-mCherry plasmid (Addgene n°41583) in CNC or TNC cells at 7ss and 14ss ...
-
bioRxiv - Immunology 2023Quote: pcDNA3-N-Flag-NLRP3 plasmid encoding mouse NLRP3 (Addgene plasmid # 75127) was a gift from Bruce Beutler61 ...
-
bioRxiv - Biochemistry 2023Quote: ... pDEST-CMV-N-EGFP was a gift from Robin Ketteler (Addgene plasmid # 122842 ...
-
bioRxiv - Developmental Biology 2024Quote: ... The gene sequences encoding N-terminally mCherry tagged Drp1 (Addgene, 49152) were inserted between the EcoRI and PstI sites of the pCDNA vector (mCherry-Drp1) ...
-
bioRxiv - Developmental Biology 2021Quote: ... N-terminal KRAB-dCas9 (a gift from Bruce Conklin, Addgene plasmid # 73498) fused with a destabilising domain ...
-
Rhes protein transits from neuron to neuron and facilitates mutant huntingtin spreading in the brainbioRxiv - Neuroscience 2021Quote: ... pEGFP-N-Drd1 plasmid was a gift from Kirk Mykytyn (Addgene, 104358), GFP-DRD2 plasmid was a gift from Jean-Michel Arrang (Addgene ...
-
bioRxiv - Biochemistry 2019Quote: ... coli Destination vector pDest-566 (N-terminal His6-MBP tag, Addgene #11517). Final baculovirus expression clones were transformed into DH10Bac cells (ThermoFisher) ...
-
bioRxiv - Molecular Biology 2019Quote: ... mCherry-SiT-N-15 plasmid was a gift from Michael Davidson (Addgene plasmid # 55133 ...
-
bioRxiv - Biochemistry 2021Quote: ... pLPC-puro-N-Flag was a gift from Titia de Lange (Addgene plasmid # 12521 ...
-
bioRxiv - Cell Biology 2021Quote: ... The resulting PCR product was inserted into pLVpuro-CMV-N-EGFP (Addgene plasmid # 122848 ...
-
bioRxiv - Neuroscience 2020Quote: ... Sham animals included virgins injected with halorhodopsin (AAV1.CaMKIIa.eNpHR.EYFP; Addgene; N=1) that received no optical stimulation ...
-
bioRxiv - Cancer Biology 2022Quote: ... DCX DNA was cloned into the N-Terminal pFLAG 3 vector (Addgene) by restriction digest using NotI and BamHI restriction enzymes ...
-
bioRxiv - Cell Biology 2019Quote: ... and mEmerald-IFT88-N-18 was a gift from Michael Davidson (Addgene plasmid # 54125 ...
-
bioRxiv - Cell Biology 2020Quote: ... mApple-SSTR3-N-17 was a gift from Michael Davidson (Addgene # 54949). SSTR3 was shuttled into CSII-EF lentiviral vector into XhoI/XbaI site by Gibson cloning using the primers aacacgctaccggtctcgagaattcatggccactgttacctatcctt and tgctcaccatcagatggctcagtgtgctgg for SSTR3 ...
-
bioRxiv - Neuroscience 2019Quote: ... an eGFP-only reporter without DREADDs (n=7; Addgene: AAV2-hSyn-eGFP), was employed in a group of control rats [65–67].
-
bioRxiv - Cancer Biology 2021Quote: ... and pcDNA3-RLUC-POLIRES-FLUC (a gift from N. Sonenberg; Addgene #45642) (Poulin et al. ...
-
bioRxiv - Microbiology 2020Quote: ... pCAG-VSV-N (#64087) and pCAGGS-T7Opt (#65974) were ordered from Addgene. S expressing pCAGGS vectors were used for the production of pseudoviruses ...