Labshake search
Citations for Addgene :
151 - 200 of 2201 citations for Human Lymphoid Enhancer Binding Factor 1 LEF1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: The monocot nlsGPS-NR control sensor amino acid sequence contains the same four charge exchange mutations as the nlsGPS2 but with the additional NR mutations (S114A and F115A in the AtGID1C binding pocket). DR5v2-ntdTomato/DR5-n3GFP and R2D2 were previously described (Liao et al. 2015) and obtained from Addgene (DR5v2/DR5 catalog #61628 ...
-
bioRxiv - Plant Biology 2024Quote: ... For N-terminal fusions with the GAL4-activation or -binding domains the vectors pGADT7-GW and pGBKT7-GW (gift from Yuhai Cui, Addgene plasmids #61702 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The AND gate constructs were optimized by making constructs with ribosome binding site library (5’-GAAAGANNNGANNNACTA-3’) in front of regulators in chemically competent Marionette Clo cells prepared from Addgene [40] ...
-
bioRxiv - Cancer Biology 2024Quote: ... dominant negative N133I (GFP-Rab27B N133I, Adddgene plasmid #89449, and geranylgeranyl-binding mutant (GER) (GFP-Rab27B GG, Addgene plasmid #89451) were gifted by Wendy Westbroek (Reference) ...
-
bioRxiv - Cancer Biology 2021Quote: The human MYC cDNA was purchased from Addgene (pDONR223_MYC_WT ...
-
bioRxiv - Molecular Biology 2019Quote: ... and a human codon-optimized Cas9 (Addgene 41815) were co-nucleofected into target cells by nucleofection (Lonza apparatus) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human ETV1 (Addgene, Cambridge, MA, USA; plasmid #82209) and ETV5 (Horizon Discovery ...
-
bioRxiv - Biochemistry 2020Quote: Plasmids encoding human full-length WDR5 (2GNQ, Addgene) or a 20aa N-terminal truncation (ΔN20 ...
-
Nonsense Mediated RNA Decay Is a Unique Vulnerability of Cancer Cells with SF3B1 and U2AF1 MutationsbioRxiv - Cell Biology 2021Quote: Human GeCKOv2 CRISPR knockout pooled library (Addgene # 1000000049) and lenti-Cas9 plasmid were obtained from addgene (Addgene # 52962) ...
-
bioRxiv - Neuroscience 2021Quote: Heterologous expression of human NaV1.2 WT (Addgene #162279)(DeKeyser et al. ...
-
bioRxiv - Cancer Biology 2021Quote: ... human TERT (LOX-TERT-iresTK; Addgene plasmid #12245), generously provided by Didier Trono ...
-
bioRxiv - Neuroscience 2022Quote: ... Human VAC14 was obtained from Addgene (Plasmid #47418) and subcloned into the mCherry- C1 vector ...
-
bioRxiv - Biochemistry 2022Quote: ... Human BIN1-EGFP (isoform 8) (Addgene plasmid #27305) was cloned in pET15b with N-terminal 6xHis and C-terminal StrepII tags ...
-
bioRxiv - Microbiology 2023Quote: The human SAM CRISPRa sgRNA library (Addgene #1000000078) was cloned into the pHW-TRPPC-NS rescue plasmid backbone for PR8 (Fig S2A ...
-
bioRxiv - Biophysics 2023Quote: Human MeCP2 in the pTXB1 plasmid (Addgene #48091) was propagated in E ...
-
bioRxiv - Immunology 2023Quote: A lentiviral construct containing human ACE2 (Addgene 155295) or mScarlet (Addgene 85044 ...
-
bioRxiv - Physiology 2023Quote: ... containing human Fis1 gene were purchased from Addgene. The working viral vectors were constructed from these two plasmids by Custom DNA Constructs ...
-
bioRxiv - Biochemistry 2023Quote: Human BIN1-EGFP (isoform 8) (Addgene plasmid #27305) and human dynamin2 C-terminally tagged to mCherry were cloned in pET15b with an N-terminal 6xHis and a C-terminal StrepII tag ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tetracycline-inducible TET-shRB1 and constitutive shRB1 constructs were created by integrating validated siRNA sequences GAAAGGACATGTGAACTTA (63) and GAACGATTATCCATTCAAA (64) targeting human RB1 (shRB1) into TET-pLKO.1-Puro vector (Addgene #21915) and pLKO.1-Puro vector ...
-
bioRxiv - Cancer Biology 2021Quote: ... plasmids were created by integrating validated siRNA sequences CCTGTCAGGAAACTGTATGAT (62) and AATGGCCATCAGAACGGACTT targeting human ESRRG (shESRRG) into pLKO.1-Puro vector (Addgene #8453). Non-specific siRNA sequence AACAGCCACAACGTCTATATC or siRNA sequence CAACAGCCACAACGTCTATAT targeting GFP were used as controls for shRNA ...
-
bioRxiv - Cancer Biology 2022Quote: The human NOTCH 1 intracellular domain (h1NICD) doxycycline-inducible expression plasmid (pLIX-h1NICD) was a gift from Julien Sage (Addgene #91897)11 ...
-
bioRxiv - Neuroscience 2021Quote: ... HEK293 cells were co-transfected with plasmids encoding wide-type myc-human TREM2 and GFP-human TDP-43 (residues 216-414, Addgene, 28197) or GFP control by the calcium phosphate precipitation method ...
-
bioRxiv - Genetics 2020Quote: sgRNA sequences targeting human USP15 were selected from the Human Brunello CRISPR knockout pooled library (Doench et al., 2016)(Addgene #73178) and further selected on the basis of high quality score in two additional online tools ...
-
bioRxiv - Cancer Biology 2021Quote: ... we amplified human KEAP1 and LKB1 off of human cDNA and used Gibson assembly to replace GFP in pMCB306 (Addgene #89360) with these sequences ...
-
bioRxiv - Biophysics 2024Quote: Human RING1b (Uniprot ID Q99496) and human BMI1 (Uniprot ID P35226) were cloned into a pFBOH-mhl vector (Addgene plasmid # 62304) cleaved with BseRI using Gibson Assembly® Master Mix (NEB #E2611L ...
-
bioRxiv - Neuroscience 2022Quote: ... the complementary DNA (cDNA) for each iMN factor (Ngn2, Lhx3, Isl1, NeuroD1, Ascl1, Brn2 and Myt1l) was purchased from Addgene and cloned into the pMXs retroviral expression vector using Gateway cloning technology (Invitrogen) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Three elements of the reporter were amplified from the following sources: five TetO binding sites upstream of a pEF promoter from PhiC31-Neo-ins-5xTetO-pEF-H2B-Citrine-ins (Addgene #78099), TagRFP-T from pEN_ERK.KTR-tagRFP-T ...
-
bioRxiv - Cell Biology 2021Quote: ... the cytosolic domain of Miro1 (Miro1(ΔTM)) and the iLID binding peptide (SspB, obtained from Addgene #60415, gift from B. Kuhlman) were fused into pmCherry-C1 using EcoRI and KpnI ...
-
bioRxiv - Immunology 2023Quote: ... expressing the firefly coding sequence under control of a synthetic promoter containing SMAD-binding elements (SBEs) was obtained from AddGene (#45126). pEFBOS mCherry-mSTING expressing monomeric Cherry fused to the N-terminus of murine STING ...
-
bioRxiv - Neuroscience 2024Quote: ... we cloned CreERT2 (Cre recombinase fused to a mutant ligand-binding domain of the estrogen receptor) and IRES into the BamHI site of pAAV-EF1a-tdTomato-WPRE-pGHpA (Addgene #67527). To prevent leakage of Cre activity34 ...
-
bioRxiv - Bioengineering 2024Quote: ... a viral expression plasmid encoding mKate2 downstream of tandem NF-κB binding sites (37) (Addgene #105173, a gift from Timothy Lu) was co-transfected with gag/pol and env vectors ...
-
bioRxiv - Cancer Biology 2021Quote: ... KRT14 mouse and Human ShRNA sequence were cloned in the 3rd generation transfer plasmid pLKO.1 TRC cloning vector (Addgene cat # 10878) between unique AgeI and EcoRI restriction sites downstream of the U6 promoter ...
-
bioRxiv - Cell Biology 2023Quote: ... pT7-EGFP-C1-HsDCP1a was a gift from Elisa Izaurralde (Addgene plasmid # 25030; http://n2t.net/addgene:25030;RRID:Addgene_25030) (Tritschler et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... human APC open reading frame purchased from Addgene (#16507), tdmirfp670nano from Max Wilson ...
-
bioRxiv - Biochemistry 2020Quote: ... Human ACE2 plasmid was obtained from Addgene (#1786, (6)) ...
-
bioRxiv - Neuroscience 2020Quote: ... the human ACE2 ORF was PCR amplified from Addgene plasmid 1786 and C-terminally fused with the porcine teschovirus-1-derived P2A cleavage sequence (ATNFSLLKQAGDVEENPGP ...
-
bioRxiv - Systems Biology 2021Quote: ... we used the human CRISPRi v2 library (Addgene #83969) (17) ...
-
bioRxiv - Cell Biology 2020Quote: ... A pMXs retroviral vector encoding human OCT3/4 (RRID:Addgene_17217), human SOX2 (RRID:Addgene_17218) ...
-
bioRxiv - Biophysics 2020Quote: ... human 3’ HP1α-AID-sfGFP 2A PuroR (Addgene 127906) and a guide RNA/Cas9 plasmid pX330 human 3’ HP1α gRNA (Addgene 127907 ...
-
bioRxiv - Microbiology 2021Quote: ... The recombinant plasmid containing human ACE2 gene (Addgene #1786) was transfected into HEK293T cells using Lipofectamine 2000 Transfection Reagent (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2020Quote: ... The human NKCC1 coding sequence was derived from Addgene plasmid # 49077 ...
-
bioRxiv - Cancer Biology 2022Quote: The human CRISPR activation pooled library Set A (Addgene plasmid #92379 was a gift from David Root and John Doench ...
-
bioRxiv - Microbiology 2020Quote: ... the human hACE2 ORF was PCR amplified from Addgene plasmid 1786 and C-terminally fused with the porcine teschovirus-1-derived P2A cleavage sequence (ATNFSLLKQAGDVEENPGP ...
-
bioRxiv - Cancer Biology 2021Quote: Wild-type TP53 from both human (Addgene plasmid #69003) or zebrafish (3 days old embryos cDNA ...
-
bioRxiv - Developmental Biology 2021Quote: Human GeCKO v2 library was obtained from Addgene (#1000000048) and amplified according to the provided instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... Human CD63 (Addgene plasmid #62964, gift from Paul Luzio) and mScarlet25 (Addgene plasmid #85042 ...
-
bioRxiv - Molecular Biology 2021Quote: ... human GFP-RBFOX2 (transcript variant 3) (Addgene, plasmid #63086) or empty vector (pcDNA 5 ...
-
bioRxiv - Cell Biology 2022Quote: ... the Bassik Human CRISPR Knockout Library (Addgene, 101926-101934) is separated into 9 sublibraries comprising a total of 225,171 elements and targeting approximately 20,500 genes (10 sgRNAs per target) ...
-
bioRxiv - Neuroscience 2023Quote: ... under the human synapsin promoter were obtained from Addgene. All viruses were stored at -80°C and aliquots were thawed over wet ice immediately prior to injection.
-
bioRxiv - Microbiology 2023Quote: The human “Brunello” CRISPR knockout pooled library (#73179, Addgene) (Doench et al. ...