Labshake search
Citations for Addgene :
101 - 150 of 2201 citations for Human Lymphoid Enhancer Binding Factor 1 LEF1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... under the control of the human synapsin-1 gene promoter (AAV-GFP/Cre, 105540-AAV1, pENN.AAV1.hSyn.HI.eGFP-Cre.WPRE.SV40, Addgene, Massachusetts, USA) or with AAV expressing only GFP (AAV-GFP ...
-
bioRxiv - Cell Biology 2020Quote: Specific shRNA1 and shRNA2 targeting human ARID1A were cloned into the pLKO.1-TRC-puro vector (Addgene), separately ...
-
bioRxiv - Genetics 2020Quote: The plasmid that contains the isoform 1 of human DNMT3B (DNMT3B1) was purchased from Addgene (cat # 35522). The DNMT3B1 cDNA was then fused to an N-terminal Flag tag by PCR ...
-
bioRxiv - Cell Biology 2023Quote: ... fibroblasts were reprogrammed using lentiviral vectors that carried six transcription factors (ADDGENE/PSIN4-EF2-N2L, ADDGENE/PSIN4-EF2-O2S and ADDGENE/PSIN4-CMV-K2M) ...
-
bioRxiv - Developmental Biology 2021Quote: ... a FoxO1 plasmid encoding a deleted DNA binding domain (amino acid 208-220) was used (Addgene #10694). After 24 hours ...
-
bioRxiv - Bioengineering 2023Quote: ... ssDNA binding protein and peptide sequences were synthesized and assembled into an AIO plasmid modified from Addgene plasmid #42230 by golden gate cloning ...
-
bioRxiv - Cancer Biology 2023Quote: ... EF.deltaBHES1.Ubc.GFP (DBD-HES1 DNA-binding domain mutant of HES1; #24982) were obtained from Addgene (Cambridge, USA). The reporter plasmids containing the firefly luciferase gene under the control of various fragments of the Hes1 promoter (2.5 kb ...
-
bioRxiv - Cell Biology 2023Quote: ... 2.5 million hPSCs were transfected with either 400ng WRE plasmid with active TCF binding sites (Addgene, 12456) or MRE plasmid with mutated TCF binding sites (Addgene ...
-
bioRxiv - Immunology 2020Quote: Soluble human ACE2 with an Fc tag was constructed by PCR amplifying ACE2 (residues 1-615) from Addgene plasmid #1786 (a kind gift from Jesse Bloom ...
-
bioRxiv - Immunology 2022Quote: shRNAs were designed to target human Galectin-9 mRNA and cloned into the pLKO.1 vector (Addgene #10878). The sense shRNA sequences are CCTGGTGCAGAGCTCAGATTT (shGal-9 #1 ...
-
bioRxiv - Cancer Biology 2023Quote: Whole genome CRISPR Screening was performed using the Human CRISPR Knockout Pooled Library (Brunello) - 1 vector system (Addgene and a gift from John Doench to the Functional Genomics Facility at the University of Colorado Anschutz Medical Campus)(44) ...
-
bioRxiv - Neuroscience 2023Quote: The following expression constructs were used: human CaV2.2 (huCaV2.2 (pSAD442-1) was a gift from Diane Lipscombe (Addgene plasmid # 62574 ...
-
bioRxiv - Developmental Biology 2021Quote: ... GST-human β-catenin (Addgene #24193), and NLS-mCherry (Addgene #49313 ...
-
bioRxiv - Molecular Biology 2022Quote: ... pscALPSpuro-HsACE2 (human) (Addgene, MA, USA) were co-transfected with psPAX2 and pCMV-VSV-G packaging plasmids into HEK293T cells using FuGENE 6 (Promega ...
-
bioRxiv - Neuroscience 2023Quote: ... human a-SYN (A53T mutant) (Addgene), and mt-Keima (Addgene) ...
-
bioRxiv - Biochemistry 2024Quote: Recombinant human GST-CK2α’ (Addgene #27084) and recombinant human GST-CK2α (Addgene #27083 ...
-
bioRxiv - Cancer Biology 2024Quote: ORF encoding human MARK2 (Addgene, 23404) was cloned into pFL system with an N-terminal Strep2SUMO tag ...
-
bioRxiv - Neuroscience 2023Quote: ... were cloned by PCR amplification of the full-length human GPCR cDNA library (hORFeome database 8.1) or the PRESTO-Tango GPCR Kit36 (Addgene Kit #1000000068). To optimize the 5-HT sensors ...
-
Upregulated GIRK2 counteracts ethanol-induced changes in excitability & respiration in human neuronsbioRxiv - Neuroscience 2024Quote: ... NPCs were induced into neurons with doxycycline-inducible transcription factor NGN2 with neomycin antibiotic selection (Addgene #99378), following the protocol described by (Ho et al. ...
-
bioRxiv - Cell Biology 2022Quote: Human FL-RING1A (1–406aa) and CSD HP1β(80–185aa) were subcloned into bacterial expression 1GFP vector (Addgene #29663) and 1B vector (Addgene #29653) ...
-
bioRxiv - Microbiology 2020Quote: ... DNA encoding residues 1-177 of both human RAC1 and CDC42 were cloned into an unmodified pET-28a (Addgene) vector that encodes an N-terminal TEV-cleavable 6xHis-tag using the NdeI/XhoI sites ...
-
bioRxiv - Neuroscience 2023Quote: ... 6 × 107 RPE1 cells were infected with the human sgRNA library (Human GeCKO v2 Library Cat#1000000048, Addgene) at an MOI of ∼0.3 ...
-
bioRxiv - Systems Biology 2021Quote: ... human knockout CRISPR v1 library (Addgene #67989) (39) ...
-
bioRxiv - Microbiology 2021Quote: The human CRISPR Brunello library (Addgene 73178) (16 ...
-
bioRxiv - Neuroscience 2022Quote: ... including the human IgG1 Fc (Addgene #145165), and mouse IgG1 Fc (Addgene #28216 ...
-
bioRxiv - Cell Biology 2023Quote: ... from human pcDNA3.1-2xFLAG-SREBP1a (#26801, Addgene), pcDNA3.1-2xFLAG-SREBP1c (#26802 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Human Sin1.1 was PCR-amplified from Addgene 73388 plasmid (gift from Taekjip Ha32 ...
-
bioRxiv - Biochemistry 2024Quote: ... and recombinant human GST-CK2α (Addgene #27083) enzymes were produced in-house as previously described [30] ...
-
bioRxiv - Microbiology 2024Quote: ... The human RAB6Q72L was subcloned from Addgene plasmid #49483 into a bacteria expression pGEX-4T-1 vector encoding a N-terminal GST tag followed by a TEV cleavage site.
-
bioRxiv - Molecular Biology 2021Quote: ... a region bearing six let-7 binding sites was PCR-amplified from MSCV puro let-7 sponge (Addgene #29766) and cloned between AgeI and EcoRI sites downstream of GFP.
-
bioRxiv - Cell Biology 2020Quote: ... PG13-luc (WT p53 binding sites) was a gift from Bert Vogelstein (Addgene plasmid # 16442; http://n2t.net/addgene:16442; RRID: Addgene_16442). Cells were transfected with Lipofectamine LTX and plus reagent or Lipofectamine 2000 (Thermo-Fisher Scientific ...
-
bioRxiv - Biochemistry 2021Quote: ... by cloning our codon optimized Syx gene into vectors containing the following tags that are cleavable with tobacco etch virus (TEV) protease: N-terminal His6 plus maltose binding protein (MBP; RRID:Addgene_29708); C-terminal MBP plus His6 (Addgene_37237) ...
-
bioRxiv - Molecular Biology 2022Quote: sgRNAs targeting selected MYC binding motifs (E-boxes) were designed using transCRISPR and cloned into lentiCRISPR_v2 vector (Addgene #5296126) (Table 2) ...
-
bioRxiv - Plant Biology 2022Quote: ... and HlWRKY1 was individually cloned into the bait vector pGBKT7-GW [DNA-binding domain (BD)] (Addgene Inc, MA, USA) to produce fusion proteins containing a GAL4 activation domain (AD ...
-
bioRxiv - Neuroscience 2021Quote: ... The BoxB reporter was pAc5.1C-Fluc-Stop-5BoxB (a gift from Elisa Izaurralde; Addgene plasmid #21301) (Behm-Ansmant et al. ...
-
bioRxiv - Cancer Biology 2023Quote: An XRN1 open-reading frame (ORF) clone deposited by Elisa Izaurralde was purchased from Addgene (#66596). The entire ORF was sequenced to confirm fidelity to the NCBI Reference Sequence NM_019001.5 ...
-
bioRxiv - Biochemistry 2020Quote: ... H-HCF-1) and full length human THAP11 cDNA with carboxy-terminal FLAG tag (Plasmid #28020; F-THAP11) were obtained from Addgene. Vectors containing full length human THAP1 cDNA with carboxy-terminal 1X FLAG tag (THAP1-F ...
-
bioRxiv - Cell Biology 2021Quote: ... The constitutively active form of kinesin-1 (human KIF5B, K560) was cloned by PCR from pet17-K560-GFP_His (Addgene, 15219) into pEGFP-N1 vector using EcoRI primer (104-5p EcoRI-K560 ...
-
bioRxiv - Cell Biology 2020Quote: ... and FLAG-tagged FL human TSC2 (1807 amino acids, UniProtKB/Swiss-Prot accession number P49815- 1) were purchased from Addgene, and pRK7 was subcloned with FLAG-tagged human TBC1D7 (293 amino acids ...
-
bioRxiv - Cancer Biology 2023Quote: ... we designed single guide RNAs to target the exon 1 of the human Per2 gene and subcloned it into the PX459 vector (Addgene) to obtain the PX459-Per2 plasmid ...
-
bioRxiv - Genetics 2024Quote: ... pLenti-CMV-HA-HHIP lentiviral expression plasmid was generated by subcloning the appropriate human HHIP cDNA PCR fragment into pLenti-CMV Blast (659–1) (Addgene). HA-tag was inserted into human HHIP cDNA after Ala 23 ...
-
bioRxiv - Cell Biology 2022Quote: ... having N of human coronavirus OC43 and pGBW-m4134901 (plasmid number 151922) having N of human coronavirus HKU1 229E were obtained from Addgene. Those N expression vectors were subcloned into pcDNA3.1 with C-terminal flag or EGFP tag ...
-
bioRxiv - Cancer Biology 2022Quote: ... encoding human KDM6A with HA tag and pCS2-UTX-F-MT2 (40619) encoding enzyme-dead human KDM6A were purchased from Addgene. The HR and NHEJ reporter plasmids were kind gifts from Tomasz Skorski (61) ...
-
bioRxiv - Cell Biology 2019Quote: The Polo-like binding domain (PBD) of PLK1 (amino acid 326 to amino acid 603) was amplified from the pTK24 plasmid (Addgene) and cloned into a pT7-His6-SUMO expression vector using NEB Gibson assembly (Gibson Assembly Master Mix ...
-
bioRxiv - Neuroscience 2021Quote: ... The amplified fragments were inserted using KpnI and MluI sites into the pCAG vector backbone containing a zinc-finger binding site upstream of a CAG promoter prepared from pCAG-GPHN.FingR-EGFP-CCR5TC (Addgene #46296)17.
-
bioRxiv - Pathology 2021Quote: ... of adeno-associated virus serotype 8 encoding Cre recombinase under the hepatocyte-specific thyroid binding globulin promoter (AAV8-TBG-Cre) (Addgene) followed by a 12 days (12d ...
-
bioRxiv - Physiology 2021Quote: ... Adeno-associated virus serotype 8 (AAV8) with the thyroxine-binding globulin promoter (TBG) promoter expressing Cre (Addgene, AV-8-PV1091) were injected via tail vein at a dose of 1×1012 genomic copies per mouse on GD8 ...
-
bioRxiv - Biochemistry 2022Quote: ... All expression constructs were in the form containing an N-terminal His6 and maltose-binding protein (MBP) tag (Addgene #11517).
-
bioRxiv - Genomics 2022Quote: ... was used to generate a list of all primers with one exact-match binding site on one of the plasmids and no exact-match binding site on the other plasmid (pcDNA3-EGFP and pLTR-RD114A from Addgene). The first round of experimental amplification used 204 primers from this list that maximized the variability in the 22 primer attributes in Table 2 ...
-
bioRxiv - Cell Biology 2022Quote: ... The pGEX2TK-Pak1 (70-117) containing the p21-binding domain (PBD) was a gift from Jonathan Chernoff (Addgene plasmid# 12217). For the purification of ARP3 (ACTR3) ...