Labshake search
Citations for Addgene :
151 - 200 of 1387 citations for Copper;5 10 15 20 tetrakis 4 methylphenyl porphyrin 22 24 diide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... and CDK6 were obtained from the Human Kinase OFR Kit from Hahn/Root Labs 24 (Addgene plasmids 23776 ...
-
bioRxiv - Neuroscience 2023Quote: ... or AAV5-hsyn-GFP (n=20; Addgene 50465 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 4 μg pUMVC (Addgene, 8449) and 18 μg transfer plasmid were mixed in 700 μL DMEM medium (Corning ...
-
bioRxiv - Neuroscience 2021Quote: ... targeted to mouse PGRN exon 1 (oligos with 5’-cacc gGCTCCCTGGGAGGCATCTGG-3’ and 5’-aaac CCAGATGCCTCCCAGGGAGCc-3’ or 5’-cacc gCGGACCCCGACGCAGGTAGG-3’ and 5’-aaac CCTACCTGCGTCGGGGTCCGc-3’ were ligated to pLenti-CRISPRv2 (Addgene)) or Cas9 only ...
-
bioRxiv - Neuroscience 2021Quote: ... were performed over a 5 min period with 1 µL of AAV9-hSyn-Cre (Titer ≥ 1×10¹³ vg/mL, Addgene, Cat. No. 105553-AAV9) or un-injected ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV2/5 (Addgene #104964), pAAV2/6 (Addgene #110660) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 4 μg of PHGDH plasmid or 4 μg of empty vector plasmid (Addgene, plasmid #52107) was mixed with 4 μg of DNA RV helper plasmid (Addgene ...
-
bioRxiv - Molecular Biology 2023Quote: Constructs for shRNA targeting Primpol (5’- ATTTAGCCGACACCTAATATT) Smarcal1 (5’- CTGATTCAAGAGAAGATTAAA) and Smug1 (5’- AACTATGTGACTCGCTACT) were designed and inserted into pLKO.1neo plasmid (Addgene #13425). Lentiviruses were generated using a standard protocol (Feng and Jasin ...
-
bioRxiv - Molecular Biology 2020Quote: ... NOCT Δ(2-15)-3F pCW57.1 was generated using the pCW57.1 (Addgene, #41393) plasmid backbone ...
-
bioRxiv - Cell Biology 2022Quote: ... human KIFC1(125-673) and mouse BICD2(15-595) were obtained from Addgene (plasmids #133242 ...
-
bioRxiv - Cancer Biology 2022Quote: ... pMRX-IP-GFP-LC3-RFP-LC3ΔG 15 a gift from Noboru Mizushima (Addgene plasmid # 84572 ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 15 μg of each of the viral envelope (pMD2.G; Addgene #12259) and viral packaging plasmids (psPAX2 ...
-
bioRxiv - Bioengineering 2023Quote: ... together with psPAX2 (15 μg) (Addgene plasmid #12260; http://n2t.net/addgene:12260; RRID:Addgene_12260) and pVSV-g (10 μg ...
-
bioRxiv - Neuroscience 2024Quote: ... STIM2 construct design was based on SP-YFP-STM2(15-746) (Addgene #18862). We replaced YFP with HaloTag and mScarletI (from Addgene #85065 ...
-
bioRxiv - Cell Biology 2024Quote: ... and FusionRed-SiT-15 (gift from Michael W. Davidson, Addgene; plasmid# 56133 [67]).
-
bioRxiv - Neuroscience 2023Quote: ... The 5-HT1eR and 5-HT1FR PRESTO-Tango constructs were obtained from Addgene. For transfection ...
-
bioRxiv - Cell Biology 2022Quote: The GFP-P2A-FLAG-K(AAA)20-P2A-mKate2 construct was modified based on GFP-P2A-FLAG-K(AAG)20-P2A-RFP (105689, Addgene). For MTS (Mitochondrial targeting sequence)- GFP-K(AAA)20-P2A-mKate2 construction ...
-
bioRxiv - Cell Biology 2024Quote: ... we expressed the GST-tagged WIPI1/2d/3/4 from a pCAG backbone encoding GST-TEV-WIPI1/2/3/4 (RRID:Addgene_223798; RRID:Addgene_223799; RRID:Addgene_223800; RRID:Addgene_223801). The protein was expressed in FreeStyleTM HEK293F cells ...
-
bioRxiv - Neuroscience 2024Quote: ... and 20% Cre-dependent GCaMP6f (AAV.CAG.Flex.GCaMP6f.WPRE.SV4089; Addgene, #100835). For SK2-KO mice ...
-
bioRxiv - Cancer Biology 2023Quote: ... 20 µL of plasmid pMIGR1 (Addgene, cat# 27490) containing the cDNA of HMX3 was combined with 62 µL of 2 M CaCl2 ...
-
bioRxiv - Neuroscience 2020Quote: [4] QF2w-Hsp70frompQF2wWB(Addgene plasmid #61313) (Primers ...
-
bioRxiv - Developmental Biology 2022Quote: ... psPAX2 (4 µg, Addgene plasmid # 12260) and pAdVAntage (1.6 µg ...
-
bioRxiv - Cell Biology 2020Quote: ... 4 μg of psPAX2 (Addgene #12260) and 8 μg of purified pLKO.1 plasmid containing the shRNA constructs upon reaching 70% confluency ...
-
bioRxiv - Developmental Biology 2024Quote: ... 4 μg of psPAX2 (Addgene, 12260), and 6 μg of GIPZ Non-silencing Lentiviral shRNA (control ...
-
bioRxiv - Biophysics 2024Quote: ... was genetically fused to the C-terminus of CD86 (Addgene plasmid #98284),[66] CTLA-4 (Addgene plasmid #98285)[66] and EGFR (Addgene plasmid #32751)[67] by replacing the fluorescent protein (mEos2 or EGFP ...
-
bioRxiv - Molecular Biology 2024Quote: ... 4 μg of psPAX2 (Addgene #12260), and 1 μg of pCMV-VSV-G (Addgene #8454 ...
-
bioRxiv - Cell Biology 2020Quote: ... 5′-CAAACAATCAGCAATGCCTG-3′ and 5′-TGAAGTATTCAGAACAGAAG-3′ and cloned into pX330-P2A-EGFP (Addgene) through ligation using T4 ligase (New England Biolabs) ...
-
bioRxiv - Cancer Biology 2021Quote: ... RRID:Addgene_10904)24 siSlug3 (SNAI2 sh2) was a gift from Bob Weinberg (Addgene plasmid # 10905; http://n2t.net/addgene:10905; RRID:Addgene_10905)24 ...
-
bioRxiv - Developmental Biology 2024Quote: ... cDNA form ovary (for foxl2l and nanos2 probe) or 24-hpf larvae (hours post fertilization) (for id1)(Addgene) were amplified by PCR (foxl2l ...
-
bioRxiv - Cell Biology 2023Quote: ... PaGFP-UtrCH was a gift from William Bement (Addgene plasmid # 26738; http://n2t.net/addgene:26738; RRID: Addgene_26738; 24). mPA-GFP-MyosinIIA-C-18 was a gift from Michael Davidson (Addgene plasmid # 57149 ...
-
bioRxiv - Immunology 2024Quote: ... The plasmid pMD2-VSVGmut was previously published and developed by our lab(24) (Addgene plasmid # 182229 ; http://n2t.net/addgene:182229 ; RRID:Addgene_182229). To generate MSCV IL-12 ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 μg pVSV (#138479, Addgene), 8 μg psPAX2 (#12260 ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 μg p8.9NdeltaSB (Addgene #132929) and 0.5 μg pCMV-VSV-G (Addgene #8454) ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV2/5 (Addgene Plasmid #104964), and pHelper (Cell Biolab ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 µg pRSV-Rev (Addgene 12253 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5 µg pRSV-Rev (Addgene 12253 ...
-
bioRxiv - Cell Biology 2024Quote: ... we expressed the GST-tagged WIPI1/2d/3/4 from a pCAG backbone encoding GST-TEV-WIPI1/2/3/4 (RRID:Addgene_223798; RRID:Addgene_223799 ...
-
Linear ubiquitination at damaged lysosomes induces local NF-κB activation and controls cell survivalbioRxiv - Cell Biology 2023Quote: ... GFP as non-human target (NHT) control (5’-GGAGCGCACCATCTTCTTCA-3’, 5’-GCCACAAGTTCAGCGTGTC-3’, and 5’-GGGCGAGGAGCTGTTCACCG-3’) cloned into pLentiCRISPRv2 (Addgene, 52961, deposited by Feng Zhang). To generate lentiviral particles ...
-
bioRxiv - Physiology 2022Quote: HEK293T cells at 60% confluence (10cm dish) were transfected for 24 hours with 14µg of pCAG-Kir2.1-T2A-tdTomato (Addgene, 60598) using 21.7µl Lipofectamine 3000 (Thermofisher ...
-
bioRxiv - Cancer Biology 2024Quote: ... and pCMV-VSV-G 24 (a gift from Bob Weinberg, Addgene plasmid # 8454; http://n2t.net/addgene:8454; RRID: Addgene_8454), into the HEK293T cells by using the TransIT-Lenti transfection reagent (Mirus Bio) ...
-
bioRxiv - Cell Biology 2024Quote: ... and 24 hours later the target plasmid was co-transfected together with the pCMV-VSV-G (Addgene plasmid # 8454) (80 ...
-
bioRxiv - Biophysics 2021Quote: Thermoplasma acidophilium 20S proteasome (pRSF-T20S, Addgene plasmid 110805) was expressed and purified essentially as described previously (55) ...
-
bioRxiv - Molecular Biology 2024Quote: ... and pAS_4xBstTyrT(CUA)_EcoTyrRS-FLAG (20) (Addgene plasmid # 140018) were gifts from Irene Coin (Leipzig University ...
-
bioRxiv - Neuroscience 2024Quote: ... the cells were reprogrammed by a mixture of retroviral vectors encoding OCT3/4 (pMXs-hOCT3/4 Addgene: 17217), SOX2 (pMXs-hSOX2 Addgene ...
-
bioRxiv - Neuroscience 2021Quote: ... and pCXLE-hOCT3/4-shp53-F (Addgene plasmid #27077 ...
-
bioRxiv - Cell Biology 2021Quote: ... 4 μg psPAX2 packing plasmid (Addgene, 12260), and 0.8 μg pMD2.G envelope plasmid (Addgene ...
-
bioRxiv - Neuroscience 2021Quote: ... and pCXLS-hOCT3/4 (Addgene plasmid #27076) episomal vectors (Okita et al. ...
-
bioRxiv - Molecular Biology 2020Quote: ... 4 μg of psPAX2 (Addgene plasmid # 12260), and 2 μg of pMD2.G plasmid (Addgene plasmid # 12259 ...
-
bioRxiv - Microbiology 2020Quote: ... 4 µg hCas9 D10A (Addgene plasmid #41816) (Mali et al. ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Insulin in pX330S-4 (Plasmid #58780, Addgene) and Glut2 in pX330S-5 (Plasmid #58781 ...