Labshake search
Citations for Addgene :
451 - 500 of 1387 citations for Copper;5 10 15 20 tetrakis 4 methylphenyl porphyrin 22 24 diide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2020Quote: ... Gal80 coding sequence was PCR amplified from pBPGAL80Uw-4 (Addgene 26235). A His2Av polyA sequence after the BFP/Gal80 coding sequence was PCR amplified from pDEST-HemmarR2 (Addgene # 112813).
-
bioRxiv - Neuroscience 2020Quote: ... AAV8-hSyn-DIO-hM3-mCherry (4×1012 vg/ml, Addgene 44362), AAV8-hSyn-hM4-mCherry (6×1012 vg/ml ...
-
bioRxiv - Genetics 2020Quote: ... Gal80 coding sequence was PCR amplified from pBPGAL80Uw-4 (Addgene 26235) using the oligonucleotides aaaaaaaaatcaaaATGAGCGGTACCGATTACAACAAAAGGAGTAGTGTGAG and GCCGACTGGCTTAGTTAattaattctagaTTAAAGCGAGTAGTGGGAGATGTTG ...
-
bioRxiv - Neuroscience 2023Quote: ... WPRE.SV40 virus (titer: 4 × 1013 GC per ml, obtained from Addgene) was lowered to a depth of 2.4 mm below the dura ...
-
bioRxiv - Genetics 2024Quote: ... along with 3 µg of pMXs.hOct4 (Octamer-Binding Protein 4, RRID:Addgene_17217), pMXs.hSox2 (SRY-Box Transcription Factor 2 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Lenti dCAS-VP64_Blast (4) was a gift from Feng Zhang (Addgene plasmid # 61425 ...
-
bioRxiv - Cell Biology 2024Quote: ... BCL2L13 I224A/L227A/W276A/I279A/I307A/V310A (ΔLIR1+3+4) (RRID:Addgene_223756). After the transformation of the pET-DUET1 vector encoding BCL2L13-GST wild-type or mutants in E ...
-
bioRxiv - Neuroscience 2020Quote: ... 10 animals received rejections of AAV5-CaMKIIa-hM4Di-mCherry (titer 9.5×10^12 GC/ml; Addgene, MA, USA), while eight animals received injections of a non-DREADD expressing viral control AAV5-CaMKIIa-EGFP (titer 4.3×10^12 GC/ml ...
-
bioRxiv - Cell Biology 2022Quote: ... Orai1-GCamp6f was a plasmid deposited in Addgene by Michael Cahalan (Addgene #73564; (20)) ...
-
bioRxiv - Neuroscience 2024Quote: ... 1:20 of final mix) was mixed with AAV5-hSyn-DIO-mCherry-WPRE (Addgene 50459 ...
-
bioRxiv - Cancer Biology 2024Quote: ... the pCX-EGFP beta5 integrin receptor 20 was a gift from Raymond Birge (Addgene plasmid # 14996 ...
-
bioRxiv - Bioengineering 2022Quote: ... and each 20-bp target sequence was subcloned into the pX330 vector (Addgene 42230). The CRISPR/Cas9 target sequences (20-bp target and 3-bp PAM sequence ...
-
bioRxiv - Molecular Biology 2024Quote: ... and electroporated with 20 µg of pSPCas9(BB)−2A- Puro V2.0 plasmid (Addgene #62988), containing either gRNA1 or gRNA2 ...
-
bioRxiv - Cell Biology 2024Quote: ... 20 ug of pooled library (Brunello Library Addgene #73178 or lab-cloned secondary library), 3 mL Opti-MEM ...
-
bioRxiv - Plant Biology 2020Quote: ... pICH47742::2x35S-5′UTR-hCas9 (STOP)-NOST (Addgene no. 49771), pICH41780 (Addgene no ...
-
bioRxiv - Neuroscience 2020Quote: ... the AAV2/5-gfaABC1D-tdTomato was purchased from AddGene (44332), and the AAV2/5-hSyn-hChR2(H134R)-mCherry was purchased from the UNC Vector Center ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 5 pmol DNA plasmids (1.5 pmol psPAX2 (Addgene #12260), 1.5 pmol pMD2.G (Addgene #12259 ...
-
bioRxiv - Neuroscience 2022Quote: ... 5 μg VSV-G expressing envelope plasmid (pMD2.G, Addgene) and 4 μg plasmid of interest (e.g ...
-
bioRxiv - Neuroscience 2022Quote: ... mRuby-ER-5 was a gift from Michael Davidson (Addgene plasmid #55860 ...
-
bioRxiv - Cancer Biology 2024Quote: ... and the PMD2.G (5 μg) envelope construct (Addgene # 12259) were added to the solution ...
-
bioRxiv - Cancer Biology 2023Quote: ... and TGFBR2 (5’-ccttgtagacctcggcgaag-3’) cloned into LentiCRISPRv2 puro (Addgene) (20) ...
-
bioRxiv - Cell Biology 2023Quote: ... the hCRISPRi-V2 compact library (Addgene #83969, 5 sgRNAs/TSS) was transduced at a MOI (multiplicity of infection <1 ...
-
bioRxiv - Neuroscience 2023Quote: ... Suppl Fig 3: AAV9-CaMKIIa-hChR2-EYFP (1:5, Addgene viral prep #26969- AAV9 ...
-
bioRxiv - Cancer Biology 2024Quote: ... or shRNAs against YAP (5’-CCGGAAGCTTTGAGTTCTGACATCCCTCGAGGGATGTCAGAACTCAAAGCTTTTTTTC -3’, cat. 27368, Addgene, pLKO1-shYAP1 was a gift from Kunliang Guan ...
-
bioRxiv - Developmental Biology 2020Quote: ... mCherry-Histone H2B-C-10 (Addgene #55057), and mCherry-LAMINB1-10 (Plasmid #55069 ...
-
bioRxiv - Cell Biology 2021Quote: ... and pSFFV_mNG2(11)1-10 (Addgene #82610), respectively ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 10 μg psPAX2 (Addgene plasmid #12260) were transfected to HEK293T cells seeded in a 15cm dish at 70% confluency ...
-
bioRxiv - Developmental Biology 2022Quote: ... 10 µg pCMV-dR8.2 dvpr (Addgene 8455), and 10 µg sgRNA plasmid using X-tremeGENE™ 9 DNA transfection reagent (Roche 06365809001) ...
-
bioRxiv - Biochemistry 2021Quote: ... 10 μg of plasmid (pBABE-puro, Addgene #1764 or pBabe-puro Ras V12 ...
-
bioRxiv - Immunology 2020Quote: ... mCherry-Dectin1A-C-10 (Addgene plasmid # 55025), and mCherry-Dectin1A-N-10 (Addgene plasmid # 55026 ...
-
bioRxiv - Immunology 2020Quote: Emerald-Dectin1A-N-10(Addgene plasmid, #56291), Emerald-Dectin1A-C-10 (Addgene plasmid # 54057) ...
-
bioRxiv - Immunology 2020Quote: ... Emerald-Dectin1A-C-10 (Addgene plasmid # 54057), mCherry-Dectin1A-C-10 (Addgene plasmid # 55025) ...
-
bioRxiv - Neuroscience 2023Quote: ... and 10 µg VSV-G (Addgene #14888) in 2 ml Opti-MEM ...
-
bioRxiv - Cancer Biology 2024Quote: ... 10 μg of pX330-p53 (Addgene 59910), and 2.5 μg of CMV-SB13 transposase ...
-
bioRxiv - Molecular Biology 2023Quote: ... TOMM20 (mCherry-TOMM20-N-10 Addgene 55146) and TFAM (pcDNA3-TFAM-mCLOVER Addgene 129574 ...
-
bioRxiv - Neuroscience 2023Quote: ... pCDNA 3.1-GFP1-10 (Plasmid #70219 Addgene) was used as the backbone to which a stop codon and a partial Kozak sequence together with the 11th part of GFP were added by reverse PCR using the blunt primers ...
-
bioRxiv - Neuroscience 2023Quote: ... tdTomato-MAPTau-N-10 (Addgene plasmid #58113) and tdTomato-C1 (Addgene plasmid #54653) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 10 µg of psPAX2 (Addgene, Plasmid #12260), 4 µg of pVSV-G (Addgene ...
-
bioRxiv - Immunology 2024Quote: ... 10 µg of pRSV-REV (#12553 Addgene), and 5 µg of phCMV-VSV-G (#8454 Addgene ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 10 μg of pMD2.G (Addgene, 12259), and 15 μg of psPAX2 (Addgene ...
-
bioRxiv - Biophysics 2024Quote: ... 10 μg of psPAX2 packaging plasmid (Addgene #12260 generated in Dr Didier Trono’s lab ...
-
bioRxiv - Neuroscience 2023Quote: We used AAV1-hSyn-GCaMP6f (2 × 1013 vg/mL Penn Vector Core/Addgene; diluted 1:8 to 1:15 in saline) for experiments involving two-photon calcium imaging of V1 layer 2/3 cells ...
-
bioRxiv - Plant Biology 2024Quote: Wheat protoplasts were isolated from 10-day-old Zahir-1644 and mutant plants and transformed (15 μg plasmid per 50,000 protoplasts) as described (46) with constructs pICH47811 (Addgene plasmid # 48008) with ubiquitin:AvrSr62-7 C-terminally tagged by full length luciferase and/or 35S:Sr62NLR in pCambia1300 backbone ...
-
bioRxiv - Neuroscience 2021Quote: ... Pups were injected bilaterally with 2 μl of AAV9-hsyn-ACh3.0 (1.8×10^13 gc/ml) and 2 μl of AAV9-hsyn-NES-jRCaMP1b (2.5×10^13 gc/ml, Addgene) per hemisphere ...
-
bioRxiv - Neuroscience 2020Quote: ... HarmPBP2 and HarmPBP3 were cloned into p10 plasmid (pJFRC-28-10-10×UAS-IVS-GFP-P10, Addgene plasmid # 36431). For phiC31 integrase-mediated P-element insertion on chromosome 2 ...
-
bioRxiv - Neuroscience 2020Quote: ... the fibroblasts were reprogrammed using the three plasmids (pCXLE-hOct3/4 [Addgene #27076] ...
-
bioRxiv - Cell Biology 2020Quote: ... The cells were transfected with 4 μg of pMD2.G (Addgene #12259), 4 μg of psPAX2 (Addgene #12260 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and pMD2G envelope plasmid (4 µg, a gift from Didier Trono; Addgene plasmid #12259 ...
-
bioRxiv - Neuroscience 2023Quote: ... we used AAV2/9-pAAV-hDlx-hM3Dq-dTomato-Fishell-4 (Addgene, 83897) and AAV2/9-pAAV-hDlx-hM4Di-dTomato-Fishell-5 (Addgene ...
-
bioRxiv - Microbiology 2023Quote: ... 6 µg of 4:2:1:1 transfer:Gag-Pol (pMDLg-pRRE, Addgene):Rev (pRSV-Rev ...