Labshake search
Citations for Addgene :
1901 - 1950 of 3022 citations for 6 methyl 5 4 phenyl 1 3 thiazol 2 yl 2 trifluoromethyl nicotinic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2019Quote: In some PV-IRES-Cre mice ChR2 was introduced by injecting 50 nL of AAV2/5-hSyn1-FLEX-hChR2-tdTomato (Addgene plasmid 41015 ...
-
bioRxiv - Neuroscience 2021Quote: Cre-dependent adeno-associated virus (AAV; serotypes 5 or 9) was used to express GCaMP6s (AAV5-Syn-Flex-GCaMP6s, Addgene), or GCaMP7f (AAV9-Syn-Flex-jGCaMP7f-WPRE ...
-
bioRxiv - Microbiology 2020Quote: The integrins subunits were overexpressed in CHO cells line with the following plasmids: Alpha 5 integrin-GFP (Addgene plasmid# 15238)50 ...
-
bioRxiv - Microbiology 2020Quote: The nucleic acid sequences of N-terminal adhesin domains of CfaE and class 5 adhesins (GenBank M55661) were cloned into a pMAL-C5X vector (Addgene) in-frame with an MBP tag to express as periplasmic proteins with improved solubility (MBP–CfaE-N) ...
-
bioRxiv - Immunology 2022Quote: ... pLenti CMV GFP Puro (658-5) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid # 17448; http://n2t.net/addgene:17448; RRID: Addgene 17448) (40) ...
-
bioRxiv - Microbiology 2023Quote: ... The second 5’-HDNT allele was replaced by a similar puromycin cassette (puro-HSV-TK-loxP) amplified from the pHJ18 plasmid (Addgene) [65] using primers p47/p48 ...
-
bioRxiv - Neuroscience 2023Quote: ... Ntsr1-Cre and Rbp4-Cre mice were stereotaxically injected with an inhibitory opsin (AAV1-hSyn-SIO-stGtACR2-FusionRed, 5 x 1011 vg/ml, Addgene) see “Virus injection and optical fiber implantation” ...
-
bioRxiv - Cell Biology 2023Quote: ... A pair of 20-mer oligonucleotides targeting the 5’ end of the dtat coding sequence was ligated into pAc-sgRNA-Cas9 (Addgene) and validated by sequencing ...
-
bioRxiv - Neuroscience 2024Quote: ... were cloned by ligating annealed oligonucleotide pairs (Supplemental table 5) into the BsmBI-digested pBPK1520 plasmid (BPK1520 was a gift from Keith Joung. Addgene#65777 ...
-
bioRxiv - Neuroscience 2024Quote: ... pegRNA plasmids for prime editing were cloned by ligating annealed oligonucleotide pairs (Supplemental table 5) into the BsaI-digested pU6-peg-GG-acceptor (pU6-pegRNA-GG-acceptor was a gift from David Liu. Addgene #132777 ...
-
bioRxiv - Neuroscience 2024Quote: ... Rats then received bilateral infusions of either AAV8-CAMKIIa-hM3D(Gq)-mCherry or AAV8-CaMKIIa-GFP (5×1012 vg/mL for both viruses; Addgene) into the VH (either A/P ...
-
bioRxiv - Neuroscience 2024Quote: ... PV-Cre mice (N = 5) were injected at the same coordinates with 250 nL of AAV-ef1a-Flex-iChloC-2A-dsRed (Addgene plasmid ...
-
bioRxiv - Molecular Biology 2019Quote: ... were cloned via BpiI into pX330S-2 and pX330S-3 (Sakuma et al., 2014) and a third vector pGEP179_pX330K (this study) according to kit instructions (Addgene Kit#1000000055, Sakuma et al., 2014). The pGEP179_pX330K plasmid is a modified entry vector generated by cloning the BsaI-pU6-sgRNA-BsaI fragment from pX330A-1×3 (Sakuma et ...
-
bioRxiv - Neuroscience 2023Quote: ... the cells were transiently transfected with green fluorescent protein (eGFP) (0.25 µg of cDNA/ml) and PIEZO1 channel plasmid (Addgene, #80925, 3 µg of cDNA/ml). For control experiments ...
-
bioRxiv - Cell Biology 2022Quote: Kinesin-1-GFP: Plasmid coding for kinesin-1-GFP was purchased from Addgene repository (#129761) ...
-
bioRxiv - Biophysics 2022Quote: ... Kinesin 1 1-401 (K401) was PCR amplified from pWC2 plasmid (Addgene # 15960). Ncd 236-701 was PCR amplified from a plasmid gifted by Andrea Serra-Marques.
-
bioRxiv - Cancer Biology 2019Quote: ... 293T cells were transfected with the sgRNA vector and a 1:1:1 mixture of lentiviral packaging constructs (Addgene #12251, #12253, #8454) using polyethylenimine transfection reagent ...
-
bioRxiv - Cancer Biology 2024Quote: HEK293 cells were cultured in 6-well plates and then transfected with 4 μg of previously described plasmid vectors encoding ER stress reporter genes ATF4-mS (#115970, Addgene, Cambridge, MA, USA), XBP1-mN (#115971) ...
-
bioRxiv - Cell Biology 2022Quote: ... IFT121 and IFT139 in IMCD-3 cells were designed using Benchling software and cloned into the pX330 vector (gift from Feng Zhang; Addgene plasmid # 42230; (Cong et al., 2013)) ...
-
bioRxiv - Cell Biology 2020Quote: ... using primer sequences 5’-TGTACCGGTCTCGAGGCCACCAT-GGTGGGTGAGG and 5’-AGATCCGGAGCTGTG-CCCCAGTTTGCTA, and cloned in place of EGFP in pT7-EGFP-C1-HsDCP1a (Tritschler et al., 2009) (Addgene # 25030). We then excised the FP635-DC-P1a cassette and blunt cloned into d2EGFPβ-glo-bin-UTR in place of the d2EGFP coding region.
-
bioRxiv - Molecular Biology 2020Quote: ... All cell lines used to assess mitotic progression (Figures 5 and S7) were generated by co-transfecting pcDNA3 encoding mCherry-tagged Histone H2B (Addgene: 20972) and pcDNA3 encoding GFP-tagged Lamin B1 (a kind gift from David Vaux) ...
-
bioRxiv - Developmental Biology 2019Quote: ... Oligonucleotides encoding sgRNA protospacer sequences (Extended Data Table 5) were annealed and cloned into pX330-U6-Chimeric_BB-CBh-hSpCas9 (a gift from Feng Zhang, Addgene plasmid # 42230) as described previously47 ...
-
bioRxiv - Cell Biology 2019Quote: ... The pDB070.iodo.5 plasmid containing the modified tRNA and tRNA synthetase for p-iodo-L-phenylalanine incorporation was obtained from Addgene (#99397) as a gift from David Liu [31] ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 sgRNAs targeting DIS3L2 (generated using the ChopChop tool (Labun et al., 2019)) were cloned into lentiGuide-Puro (Addgene #52963). The individual sgRNAs were subsequently transduced into MCF10a cells stably expressing pHR-SFFV-dCas9-BFP-KRAB (Addgene #46911 ...
-
bioRxiv - Cell Biology 2021Quote: ... 5’CACCGTGCAGCCCCCATAGCAGGTG and 5’AAACCACCTGCTATGGGGGCTGCAC) were synthesized by ID&T (Leuven, Belgium) and cloned into the pSpCas9(BB)-2A-Puro plasmid (pXP459, Addgene #48139). HeLa cells were co-transfected with the two RNF213-targeting plasmids with Lipofectamine 3000 (L3000008 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Lentiviruses delivering sgRNA were packed by transfecting about 70% confluent HEK293T cells cultured in T75 flasks with 5 µg pCMV-VSVG (Addgene 8454), 10 µg pCMV-dR8.2 dvpr (Addgene 8455) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Synthetic and control promoter parts were assembled with the omega 5’ untranslated region from tobacco mosaic virus (5UTR-ΩTMV; pICH41402, Addgene #50285), the coding sequence of firefly luciferase (LucF ...
-
bioRxiv - Microbiology 2021Quote: Design of the guide RNA targeting the region between Dicer 5’-UTR and its first coding exon for CRISPR/Cas9 mediated knock-in was carried out using the CRISPOR Design Tool [86]. Annealed oligonucleotide corresponding to the gRNA (Supp. Table 5) were cloned into the vector pX459 (Addgene #48139) which also encodes S ...
-
bioRxiv - Cell Biology 2021Quote: ... and 1.5 million cells were resuspended in Mirus nucleofector solution and electroporated with 5 ug of px458 plasmid (Addgene plasmid #48138) containing a small guide RNA (see Table S1 for oligonucleotide information ...
-
bioRxiv - Neuroscience 2020Quote: ... cells were transfected with a combination of three plasmids: 5 μg of pMD2.G (gift from Didier Trono, Addgene plasmids #12259), 15 μg of psPAX2 (gift from Didier Trono ...
-
bioRxiv - Microbiology 2020Quote: ... Plasmids were then linearized with MluI and 2μg of plasmid was transfected into 5×105 HEK293 cells together with a plasmid encoding the T7 polymerase 63 (Addgene 65974) using calcium phosphate ...
-
bioRxiv - Cell Biology 2022Quote: ... 5 x 104 MDCK II cells were transiently transfected with pSpCas9(BB)-2A-Puro (PX459) plasmids (Addgene, plasmid #62988, MA, USA) (Ran et al. ...
-
bioRxiv - Plant Biology 2023Quote: ... and MOM1 CMM2 domain (aa1660-aa1860)5 were first cloned into gateway entry vectors followed by LR reaction with pGBKT7-GW (Addgene 61703) and pGADT7-GW (Addgene 61702 ...
-
bioRxiv - Neuroscience 2023Quote: ... 2014) AAV2-hSyn-DIO-hM4D(Gi)- mCherry vector (titer ≥ 5×10¹² vg/mL) was attained from AddGene (catalog number 44362-AAV2). Rats were anesthetized with 2.5% isoflurane ...
-
bioRxiv - Genomics 2023Quote: ... a plasmid encoding a sgRNA that targets the 5’ coding sequence of bc10 (GP01409) was co-injected with pCRISPaint-T2A-Gal4-3xP3-RFP (Addgene #127556) into nos-Cas9attP40 embryos ...
-
bioRxiv - Plant Biology 2023Quote: ... The construct contains a Cas9 expression cassette driven by the CaMV 2×35S promoter and 5’UTR and guide RNA (Ueta et al. 2017) scaffold driven by the AtU6 promoter (Kamoun Lab, Addgene #46968). The AtU6-gRNA-7xT fragment was cloned into level-1 plasmid (SlIAA9-gRNA3 ...
-
bioRxiv - Microbiology 2023Quote: ... lentiviral particles pseudotyped with the VSV-G protein were produced by cotransfecting HEK293T cells in 10cm dishes with 5 mg pLentiCMVPuroDEST vector (Addgene, #17452), 2 mg VSV-G Env expression vector pMD2.G (Addgene #12259 ...
-
bioRxiv - Neuroscience 2023Quote: ... Two gRNA spacer sequence targeting the 5’UTR immediately before the start codon of gcm were first cloned into pAC-U63-tgRNA-nlsBFPnls (Addgene 169029) (78 ...
-
bioRxiv - Cell Biology 2023Quote: The PM-targeting sequence MyrPalm was amplified by PCR and ligated at the 5’ of the cameleon D1cpv-encoding sequence (Addgene #37479) into pcDNA3.
-
bioRxiv - Cell Biology 2023Quote: ... 25 μg of pT/Caggs-NRASV12 or pT/Caggs-NRASV12/D38A and 5 μg of PT2/c-Luc//PGK-SB-13 (Addgene, 20207) were suspended in 0.9% saline solution at a final volume of 10% of the body weight and injected via the tail vein within 8 seconds ...
-
bioRxiv - Neuroscience 2024Quote: ... two 5 weeks old rats habituated to tickling underwent unilateral injection of 100 nl at 30 nl/min of AAV2/5.hsyn.eGFP (Addgene, 50465-AAV5) in the insular cortex at the following coordinates ...
-
bioRxiv - Genomics 2024Quote: ... respectively),25 modified scaffold sequence was 5′GTTTAAGAGCTATGCTGGAAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGAA AAAGTGGCACCGAGTCGGTGC,60 and RNA structural motif for epegRNAs was tevopreQ1 (5′-CGCGGTTCTATCTAGTTACGCGTTAAACCAACTAGAA).40 pegRNAs and epegRNAs used the pU6-sgRNA-EF1Alpha-puro-T2A-BFP (Addgene #60955)35 backbone ...
-
bioRxiv - Microbiology 2022Quote: ... or pLKO.1-blast (pLKO.1-blast was a gift from Keith Mostov (Addgene plasmid #26655 ...
-
bioRxiv - Neuroscience 2021Quote: ... Constructs included: AAV2/1-hSynapsin-1-jGCaMP8 constructs (pGP-AAV-syn1-jGCaMP8f-WPRE, Addgene plasmid #162376 ...
-
bioRxiv - Neuroscience 2020Quote: ... or 1 μl of AAV5-hSyn-DIO-mCherry (1012 particles.ml−1, Addgene, #50459-AAV5). The virus was infused at a rate of 0.2 μL.min−1 using microinjection cannula (33-gauge ...
-
bioRxiv - Molecular Biology 2020Quote: ... were diluted (1:100) and cloned into pLKO.1 TRC-Cloning vector (Addgene # 10878) that had been digested with EcoRI and AgeI ...
-
bioRxiv - Neuroscience 2022Quote: ... 1 μL of AAV9-hsyn-cre-2a-tdT (Addgene#107738, titer ∼1×10^13) was diluted with 3 μL of PBS and was injected into the subarachnoid space of one hemisphere at the level of somatosensory cortex in Mtor-floxed-5XFAD mice ...
-
bioRxiv - Developmental Biology 2023Quote: ... ZIF-1 and GFP-nanobody::ZIF-1 sequences were amplified from pOD2046 (Addgene #89367) (Wang et al ...
-
bioRxiv - Developmental Biology 2023Quote: ... apr-1 and ecps-1 were obtained from a library supplied by Ahringer (Addgene) (Kamath et al ...
-
bioRxiv - Molecular Biology 2020Quote: ... residues 1-271 (Addgene #138421), and residues 1-133 (Addgene #138422 ...