Labshake search
Citations for Addgene :
1701 - 1750 of 3022 citations for 6 methyl 5 4 phenyl 1 3 thiazol 2 yl 2 trifluoromethyl nicotinic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... an XhoI restriction site was generated 5’ of the GFP-gene in pDRGFP (Addgene plasmid #26475)23 and the GFP-gene was replaced by the eBFP1.2 gene using the XhoI/NotI restriction sites ...
-
bioRxiv - Physiology 2022Quote: ... The control virus AAV2/5-hSyn-DIOmCherry was ordered from Penn Vector Core (Addgene plasmid 50459). Animals were allowed to recover from stereotaxic surgery for a minimum of 21 days before initiation of any experiments ...
-
bioRxiv - Molecular Biology 2023Quote: ... and guide cassettes were assembled into pGGG-M along with end linker pELE-5 (Addgene #48020). The resulting plasmid was named pGGG-TaDMC1-D and sequenced to ensure authenticity before transferring to Agrobacterium.
-
bioRxiv - Molecular Biology 2023Quote: ... Three clones with the correct insertion were transiently transfected with either 5 μg pFlpO (Addgene #13793) to remove the neomycin selection cassette or both 5 μg pFlpO (Addgene #13792 ...
-
bioRxiv - Neuroscience 2023Quote: ... or eYFP alone as a control (AAV-EF1a-DIO-eYFP; serotype 5; Dr. Karl Deisseroth; RRID:Addgene_27056).
-
bioRxiv - Cancer Biology 2023Quote: The sgRNAs specific for 5’ to the region of interest were cloned in pLentiCRISPRv2 (Addgene, #52961). sgRNAs corresponding to 3’ to the region of interest was cloned in pDecko-mCherry (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: ... in VTA of TH-Cre rats (N=5) or simultaneously expressing AAV9-rTH-PI-Cre (AddGene #107788 ...
-
bioRxiv - Neuroscience 2023Quote: ... neurons were transduced with AAV9-Syn (5 x 109 gc per well) encoding jGCaMP8s (AddGene 162374) or CaBLAM (in house prep) ...
-
bioRxiv - Cell Biology 2020Quote: ... pLenti [CM V/GFP/Hygro] (656-4) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid #17446). The cut backbone vector was treated with Antarctic Phosphatase (cat# M0289S ...
-
bioRxiv - Neuroscience 2021Quote: ... Subset of pups were bilaterally injected with 4 μl AAV9-hsyn-EGFP (3.4×10^13 gc/ml, Addgene) or 4 μl ACh3.0 (1.8×10^13 gc/ml ...
-
bioRxiv - Cancer Biology 2022Quote: ... pLenti CMV GFP Hygro (656-4) was a gift from Eric Campeau and Paul Kaufman (Addgene plasmid #17446; http://n2t.net/addgene:17446; RRID:Addgene_17446)65 ...
-
bioRxiv - Biochemistry 2022Quote: HEK293T cells were transiently transfected with pGP-CMV-GcAMP6s (Ca2+ Sensor plasmid, Addgene, Cat. no. 40753; 4 µg), 5HT2c receptor (as positive control ...
-
bioRxiv - Cell Biology 2021Quote: ... and subcloned into pLenti-CMV-GFP-Hygro (656-4) (gifted from Eric Campeau & Paul Kaufman; Addgene plasmid # 17446) using NEBuilder® HiFi DNA Assembly Kit (NEB ...
-
bioRxiv - Cancer Biology 2021Quote: The genome-wide Brie CRISPR-KO library (4 sgRNAs per gene; ~ 80.000 sgRNAs) was purchased from Addgene (#73632) and amplified according to the supplier’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... Transfection was performed with control vector (pcDNA/GW-40/LacZ) or 4 μg pARID1A (Addgene catalogue number 39311) using FuGENE 6 Transfection Reagent (Promega ...
-
bioRxiv - Biochemistry 2021Quote: ... Electrocompetent BW25113 cells were co-transformed with the pORTMAGE-4 plasmid (Addgene plasmid #72679, courtesy of Csaba Pál) and the pBAD-yTrm5 plasmid ...
-
bioRxiv - Neuroscience 2022Quote: ... rAAV2/9 encoding jRGECO1a under control of the human synapsin promoter (4 × 1013 gc/ml; customized from AddGene plasmid #61563 ...
-
bioRxiv - Neuroscience 2022Quote: ... Pups were injected bilaterally with 4 ul of AAV9-hSyn-NES-jRCaMP1b (2.5×10^13 gc/ml, Addgene). Mice also received an injection of AAV9-hSyn-GRABACh3.0 to express the genetically encoded cholinergic sensor GRABACh3.0 48 ...
-
bioRxiv - Cancer Biology 2023Quote: KEAP1-sg1 knockout H1299 (4 x 105) cells were transfected with or without plasmid expressing Halo-KEAP1 (Addgene, a gift from Yimon Aye ...
-
bioRxiv - Bioengineering 2023Quote: ... followed by addition of the plasmid cocktail containing 4 µg of pMD2.G (a gift from Didier Trono; Addgene plasmid # 12259; http://n2t.net/addgene:12259; RRID:Addgene_12259), 10 µg of psPAX2 (a gift from Didier Trono ...
-
bioRxiv - Biochemistry 2024Quote: ... a ∼1:1:1 molar ratio mixture of library transfer (lentiCRISPRv2; Addgene plasmid #52961) and packaging plasmids (psPAX2 ...
-
bioRxiv - Neuroscience 2021Quote: ... DJ-1 (pGEX-5X-1-DJ1-WT; Addgene) or pcDNA plus RFP plasmid(57 ...
-
bioRxiv - Cancer Biology 2021Quote: Indicated cell lines were transfected using lipofectamine 3000 with 3 µg of p65 reporter plasmid (pHAGE NF-κB-TA-LUC-UBC-GFP-W plasmid from Addgene #49343). After 48h ...
-
bioRxiv - Cell Biology 2020Quote: ... A template vector which carries full-length AID-3 × FLAG-P2A-BSD was produced with the backbone of pMK392 (Addgene, 121193). Full-length AID-3×FLAG-P2A-BSD was integrated into the site just before the terminal codon of the sub-cloned CENP-E gene ...
-
bioRxiv - Genetics 2021Quote: ... hermaphrodites were injected with 0.25ng/μl mks-3::gfp and 100ng/μl coel::dsRed (gift from Piali Sengupta, Addgene plasmid #8938) to generate extrachromosomal arrays (1-7 lines each) ...
-
bioRxiv - Developmental Biology 2020Quote: The LV-MiniP-H2B-GFP vectors were prepared by inserting the respective MimiP sequences (24) into the LV-H2B-GFP vector (3) (Addgene, #25999) using PCR introduced SalI ...
-
bioRxiv - Molecular Biology 2021Quote: ... For the generation of the double K73E K80E (2KE) sov mutant two guides (Supplementary Table 3) were cloned into pDCC6 (Addgene 59985) and co-injected with an AltR HDR donor oligo (IDT ...
-
bioRxiv - Genomics 2020Quote: ... The INTS6 ORF was PCR amplified with 5’ Xho I and 3’ EcoRI restriction site overhangs and the coding sequence for a C-terminal V5 epitope tag was added in frame to the 3’ end of the INTS6 ORF (Key Resources Table. The INTS6 PCR product and MSCVpuro vector (Addgene 68469) were digested with XhoI (NEB R0146 ...
-
bioRxiv - Genetics 2021Quote: ... Putative enhancers were attached to a pes-10 minimal promoter::HIS-24::mCherry::let-858 3’UTR fragment amplified from POPTOP plasmid (71) (Addgene #34848) by using PCR stitching to create an enhancer reporter which was sequence verified and purified with a PureLink PCR purification kit (ThermoFisher ...
-
bioRxiv - Cell Biology 2021Quote: ... The UAS sites and K10 3’UTR were replaced via PCR with the squash promoter and squash 3’UTR from pBS-Squ-mCherry (Eric Wieschaus56, Addgene 20163). The RhoGEF2 ORF was obtained from the DGRC (SD04476) ...
-
bioRxiv - Biochemistry 2021Quote: ... The PCR products were used as templates for final PCR using 5’ GGGGTACCGAA GTAAAACTTTAACTTCA G 3’ and 5’ CCGCTCGAGCTAATGATGATGATGATGATGC AATCCCCGAGACTTGTA C 3’ primer pair (KpnI and XhoI sites are underlined respectively) and cloned into pIB3 vector (cat # 25452, Addgene, USA). Similar strategy was used for PGAPDH-PEPCKDPRPEPCKMyc construct generation ...
-
bioRxiv - Cell Biology 2021Quote: ... The sgRNA (100 ng/μl) and SEC repair template (20 ng/μl) plasmids combined with Peft-3::Cas9 (60 ng/μl; Addgene #46168) and Pmyo-2::mCherry co-injection marker (2.5 ng/μl ...
-
bioRxiv - Cell Biology 2021Quote: ... the rps-0 promoter and the unc-54 3’ UTR fragments were combined and inserted into the pMLS257 plasmid (Addgene #73716) using the SapTrap assembly method (Schwartz and Jorgensen ...
-
bioRxiv - Cell Biology 2021Quote: ... Expression vectors for NFAT4 D-site variants were prepared by subcloning residues 3 – 407 of WT NFAT4 from the corresponding mammalian expression vector (Addgene #21664) into pGEX4T1 ...
-
bioRxiv - Genetics 2021Quote: ... uracil glycosylase inhibitor (UGI) and 3’UTR of human ATP5B was amplified from the published DdCBE construct (Addgene plasmid no. 157843). The PCR product was digested with the restriction enzymes XbaI and EcoRI ...
-
bioRxiv - Immunology 2020Quote: ... Coding sequences of human full-length TREM2 (NM_018965.3) and the Δe2 isoform were synthesized and cloned into the doxycycline-inducible lentiviral pCW57-MCS1-2A-MCS2 vector (Addgene, #71782). For “add-back” experiments ...
-
bioRxiv - Cell Biology 2021Quote: ... the 5’ homology arm (540 bp) and 3’ homology arm (542 bp) were cloned respectively into pENTR2-L3-SfoI-Venus-PBL-R1 (Addgene #141019) and pDONR-P2rP4 (Addgene #141015 ...
-
bioRxiv - Genetics 2022Quote: ... Enhancer reporters were produced by fusing via PCR stitching these constructs to a pes-10 minimal promoter::HIS-24::mCherry::let-858 3’UTR fragment amplified from the POPTOP plasmid [53] (Addgene #34848). The enhancer reporters were purified with a PureLink PCR purification kit (ThermoFisher ...
-
bioRxiv - Immunology 2020Quote: ... sgRNAs targeting the endogenous Rosa26 locus or 3’ end sequence of the Wapl gene were cloned by annealing pairs of oligos into pX330 (Addgene, #42230) to construct the pX330_Rosa26 and pX330_Wapl-mAID ...
-
bioRxiv - Developmental Biology 2021Quote: ... Human TBX5 (Horizon Discovery OHS5894-202500411) was gateway sub-cloned from its entry vector pENTR223 into the expression vector pCSf107mT-Gateway-3’myc (Addgene 67617) using clonase (ThermoFisher 11791020 ...
-
bioRxiv - Neuroscience 2020Quote: ... was generated by subcloning the 5’ (7833 bp) and 3’ (1921 bp) genomic sequences from the Ir75a-Gal4 transgene22 to flank CD4:tdGFP in pDESTHemmarG (Addgene 31221)86 ...
-
bioRxiv - Pathology 2019Quote: ... of 5’ UTR and 3’ UTR regions were PCR amplified and ligated sequentially to flank the ILV2SUR sulfonylurea-resistance cassette in pFGL820 (Addgene, 58221) (Figure S2a) ...
-
bioRxiv - Genomics 2021Quote: ... a primer binding site and restriction sites for SgsI and SdaI into the Bsp1704I site at the 3’ end of the GFP coding region of pcDNA3-EGFP (Addgene #13013). The modified plasmid was cut with SgsI and SdaI (Fermentas FastDigest ...
-
bioRxiv - Microbiology 2022Quote: GFP and myc-tagged 14-3-3ε were generated as follows: a G-block containing the full-length 14-3-3ε protein (IDT) was cloned into pEGFP-C1 (Addgene #2487) using XhoI and BamHI restriction sites ...
-
bioRxiv - Biophysics 2022Quote: An sgRNA targeting the 3’UTR of TCOF1 proximal to the stop codon was cloned into the Cas9-containing plasmid PX458 (Addgene, 48138) by golden gate cloning ...
-
bioRxiv - Cell Biology 2022Quote: ... gRNA or a tandem cassette of 3 gRNAs targeting FBXL4 was cloned into AAV-U6-gRNA-CAG-mtKeima-WPRE-hGHpA (modified from Addgene, 60229) under the U6 promoter ...
-
bioRxiv - Molecular Biology 2022Quote: ... and g2 (5’- CCATGTATGGGGTCACAGCCTCTGCTAGGACCAAGCCAAGACCATCTGCTGTCACAACCACTGC ACACCTGG-3’) and cloned these guides into the All-in-one (AIO)-PURO vector encoding the Cas9D10A nickase (Addgene #74630). U2OS cells were treated with 2 µg/mL of puromycin (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... We also note that we also attempted to create an SPR-T2A-GAL4 using the pC-(lox2-attB2-SA-T2A-Gal4-Hsp70)3 construct (Addgene #62957), but no founders emerged (potentially owing to lethality when these construct elements are inserted in the SPR locus) ...
-
bioRxiv - Genetics 2023Quote: ... pSL832 [phlh-3::nls::gfp lacZ] was created by amplifying nls::gfp::LacZ from pPD96.04 (a gift from Andrew Fire, Addgene plasmid # 1502) and inserting this amplicon into a pSL780 backbone (phlh-3::lifeact::mKate2) ...
-
Neural mechanisms underlying uninstructed orofacial movements during reward-based learning behaviorsbioRxiv - Neuroscience 2023Quote: ... 5’-AAACTCCACTCTCTTAGGGAATACCC-3’) were ligated into a plasmid pX601-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA;U6::BsaI-sgRNA (pX601, Addgene #61591) digested with BsaI (R0535 ...