Labshake search
Citations for Addgene :
1851 - 1900 of 2227 citations for 8 phenylamino 5 4 5 sulpho 1 naphthyl azo 1 naphthyl azo naphthalene 1 sulphonic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: The lentivirus shRNA plasmids targeting mouse RelA and Pkci were generated by cloning annealed oligos into AgeI and EcoRI sites of pLKO.1-hygro-ctrl plasmid (Addgene #24150). Following target sequences and oligos were utilized ...
-
bioRxiv - Cell Biology 2022Quote: ... the PCR-amplified fragment of pie-1p::gfp::PH::pie-1 3’UTR was inserted into pCFJ1662 (a gift from Erik Jorgensen, Addgene #51482). Plasmid mixtures containing pCFJ1662_PH ...
-
bioRxiv - Developmental Biology 2023Quote: ... shortened to 19 bp length and flanked with BbsI overhangs. Corresponding oligonucleotides (Suppl. Table 1) were inserted into BbsI-digested pX330-U6- Chimeric_BB-CBh-hSpCas9 (obtained from Addgene, plasmid #42230) 35 to generate pX330- Ep400-Ex15 and px330-Kat5-Ex8 ...
-
bioRxiv - Microbiology 2023Quote: ... HUDEP-2 were transduced at an MOI <1 with lentivirus prepared from pXPR_101 (lentiCas9-blast, gift from Feng Zhang, Addgene plasmid 52962) and selected with blasticidin ...
-
bioRxiv - Cell Biology 2023Quote: ... CFP-GAI-MTM1 was made by inserting MTM1 from mCherry-FKBP-MTM1 after GAI in CFP-GAI(1-92) (gift from Takanari Inoue, Addgene # 37307). LysoYFP-GID1 was made by inserting Lyso from LysoGFP-Sac1 before YFP in YFP-GID1 (gift from Takanari Inoue ...
-
bioRxiv - Cancer Biology 2024Quote: ... generated by transduction of MDA-MB-231 (named in short MB-231) with lentiviral vectors carrying pLKO.1 plasmid (Addgene, 8453) cloned with shANP32E-808 (sh sequence ...
-
bioRxiv - Cancer Biology 2023Quote: Engineering of Luc-tagged HCC1954 cells (HCC1954-Luc) and tumour implantation: the pLenti CMV Puro LUC (w168-1) was purchased from Addgene (#17477) and used in all in vivo experiments ...
-
bioRxiv - Molecular Biology 2023Quote: ... containing 10% FBS and 1% penicillin-streptomycin, and equal amounts of plasmids (250 ng of each: luciferase reporter, actin-GAL4 (Addgene #24344), one dCas9-Rb constructs ...
-
bioRxiv - Neuroscience 2023Quote: ... To express the calcium indicator GCaMP6s in neuronal cell bodies or long-range projection axons either AAV5-Syn-GCaMP6s or AAV1-Syn-GCaMP6s (1−1013 gc/mL; Addgene #100843) was injected into the relevant brain region ...
-
bioRxiv - Neuroscience 2024Quote: ... An intersectional approach was used for selective activation of mPFC to BLA projection using chemogenetics: 1) retrograde AAV encoding FlpO (0.3 μL, titer ≥ 7 x 1012 GC/ml, Addgene# 55637; RRID:Addgene_55637) were bilaterally injected into BLA (A-P ...
-
bioRxiv - Cancer Biology 2024Quote: Guide RNA (gRNA) sequences targeting neutral sphingomyelinases 1 & 2 and Rab27s a and b were cloned into a lentiCRISPR vector (Addgene (52961) 45 ...
-
bioRxiv - Cell Biology 2024Quote: ... 1 × 106 cells were plated in 60 mm dishes for 24 hours followed by transfection with m6A-Tracer GFP (AddGene, 139403) and DAM-lamin B1 (AddGene ...
-
bioRxiv - Immunology 2024Quote: Stable Cas9 expression was established in human B-cell lines (WSU-FSCCL, HBL-1 and SUDHL5) using lentiviral transduction of lentiCas9-Blast (Addgene #52962). Cells were incubated with 10µg/ml polybrene (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2024Quote: ... 5% FBS,0.01% Sodium Pyruvate) were transfected according to manufacturer instructions using Lipofectamine 2000 with plasmids carrying HIV-1 Gag/Pol (pMDLg/pRRE Addgene: 12251), HIV-1 Rev (pRSV-Rev Addgene ...
-
bioRxiv - Cell Biology 2024Quote: ... mScarlet-i-PLEKHA5WW was made by inserting the cDNA sequence encoding the tandem WW domain (residue 1-105) into the CMV-mScarlet-i-C1 vector (Addgene 85044) using BamHI and SalI ...
-
bioRxiv - Neuroscience 2024Quote: ... Site-directed integration into attP sites was achieved by co-injection of an attB-containing vector (400 ng µl-1) and pBS130 (encoding ΦC31 integrase under control of a heat shock promoter (Addgene #26290) (Gohl et al. ...
-
bioRxiv - Neuroscience 2024Quote: ... a plasmid with the synapsin-1 promoter that controls the expression of the biosensor GCaMP6 and fused to the red fluorochrome mRuby2 (Addgene, # 50942); and hSyn-HyPer ...
-
bioRxiv - Molecular Biology 2024Quote: ... the sgRNA coding sequence (Supplementary Table 1) was cloned into pX459 V2.0 vector (a gift from Feng Zhang; Addgene plasmid 62988)63 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... with library plasmid amount corresponding to 1 plasmid per cell and 20 ug of base editor pCMV-T7-ABE8e-nSpCas9-P2A-EGFP (KAC978) (Addgene #185910). Genomic DNA was collected from cells 5 days after transfection.
-
bioRxiv - Molecular Biology 2024Quote: ... the rtTA3 gene fused to the blasticidin resistant marker (BlastR) was adapted from the pLenti CMV rtTA3 Blast (w756-1) plasmid (Addgene, 26429).
-
bioRxiv - Molecular Biology 2020Quote: ... 4 μg of PHGDH plasmid or 4 μg of empty vector plasmid (Addgene, plasmid #52107) was mixed with 4 μg of DNA RV helper plasmid (Addgene ...
-
bioRxiv - Neuroscience 2021Quote: ... The amino acid sequence for the engineered APEX2 was taken from Addgene plasmid #212574 ...
-
bioRxiv - Neuroscience 2023Quote: ... the signal peptide (0-26 amino acids) of pro-opiomelanocortin (#176704, Addgene) and ectodomain (52-750 amino acids ...
-
bioRxiv - Cancer Biology 2021Quote: ... A 370 bp fragment of genomic DNA containing miRNA miR-34c was cloned into the Xho I and Mlu I restriction sites of the pLKO.1 vector (Addgene plasmid #52920) to express miR-34c (32) ...
-
bioRxiv - Developmental Biology 2021Quote: ... 1-cell stage embryos were injected with a 1 nl mix of approximately 56-60 pg sgRNA and 190 pg cas9 mRNA (Addgene plasmid #47322). Mosaic embryos were raised to adulthood and crossed with Tupel Long fin (TL ...
-
Rab35 Governs Apicobasal Polarity Through Regulation of Actin Dynamics During Sprouting AngiogenesisbioRxiv - Developmental Biology 2022Quote: ... The destination vector used in this study was pLenti CMV Neo DEST (705-1) (gift from Eric Campeau & Paul Kaufman; Addgene plasmid #17392). Once validated ...
-
bioRxiv - Cancer Biology 2020Quote: ... To generate inducible CRISPR-Cas9 GFPT2 KO cell lines, parental cells (H460, H157, Calu-1) were first infected by pCW-Cas9 plasmid (Addgene plasmid #50661), sorted by puromycin selection ...
-
bioRxiv - Cell Biology 2020Quote: ... and subcloned into pcDNA3.1-MCSBirA(R118G)-HA vector (a gift from Kyle Roux, Addgene plasmid #36047; http://n2t.net/addgene:36047; RRID:Addgene_36047, (Roux et al, 2012)) ...
-
bioRxiv - Cancer Biology 2021Quote: ... KRT14 mouse and Human ShRNA sequence were cloned in the 3rd generation transfer plasmid pLKO.1 TRC cloning vector (Addgene cat # 10878) between unique AgeI and EcoRI restriction sites downstream of the U6 promoter ...
-
bioRxiv - Neuroscience 2020Quote: AAV-SYN-flex-PSAM4-GlyR-IRES-EGFP was a gift from Scott Sternson (Addgene viral prep # 119741-AAV5; http://n2t.net/addgene:119741; RRID:Addgene_119741; >1×1013 vg/ml). Control virus was AAV1-EF1α-DIO-eYFP (>1×1013 vg/ml ...
-
bioRxiv - Neuroscience 2020Quote: ... the promoter was substituted by mDlx enhancer sequence from pAAV-mDlx-GFP-Fishell-1 (a gift from Gordon Fishell, Addgene plasmid # 83900) and cDNA encoding mCherry was further inserted into multicloning site 21 ...
-
bioRxiv - Neuroscience 2020Quote: ... two viruses were injected in the same animal: AAV1-Syn-NES-jRGECO1a-WPRE-SV40 (Addgene; 1 × 1013 GC/mL titer, 294.4 nL) in Cg1/M2 ...
-
bioRxiv - Plant Biology 2021Quote: ... pICH47811-pTCSn::nls:tGFP (position 2) was cloned together with pICH47802-pIPT3::nls:tdTOMATO::t35S (position 1) in the final plant expression vector pAGM4673 (Addgene, catalog number: 48014).
-
bioRxiv - Plant Biology 2021Quote: ... was cloned together with pICH47802-p35S::ER:tdTOM::tNOS selection marker (position 1) in the final plant expression vector pAGM4673 (Addgene, catalog number: 48014). For simultaneous live imaging ...
-
bioRxiv - Neuroscience 2020Quote: The GECI AAV2/1-Syn-FLEX-mRuby2-CSG-P2A-GCaMP6m-WPRE-SV40 (titer: 2.9 x 1013 GC per ml, Addgene accession no. 102816) in combination with the Cre recombinase AAV2/1.CamKII0.4.Cre.SV40 (titer ...
-
bioRxiv - Genomics 2021Quote: ... 100 ng of a synthetic gblock encoding the the HS-CRM8-TTRmin module38 upstream of dsRed (Integrated DNA Technologies) and 1 μg of sgOpti (gift from Eric Lander and David Sabatini, Addgene plasmid #85681)39 ...
-
bioRxiv - Cell Biology 2021Quote: ... A control cell line was generated by infecting U2OS cells stably expressing a non-targeting sgRNA (above) with the lentivirus vector pLKO.1-blast-Scramble (Addgene, cat# 26701) expressing a non-targeting shRNA sequence and selected with 15µg/ml blasticidin for 7 days ...
-
bioRxiv - Cell Biology 2020Quote: WT and JMS hiPSCs were transduced with lentiviruses encloding for the non-specific control short-hairpin RNA (shControl; pLKO.1 puro (Addgene ID: 8453)) or the p53 targeting shRNA (shp53 pLKO.1 puro shRNA (Addgene ID ...
-
bioRxiv - Biochemistry 2022Quote: ... and CstF77 (Uniprot Q12996-1) were cloned into ligation-independent cloning (LIC) expression vectors 1B (gift from Scott Gradia, Addgene plasmid #29653), 1M (Addgene plasmid #29656) ...
-
bioRxiv - Neuroscience 2022Quote: ... P0-1 pups received the viral construct AAV9-hSyn-hChR2(H134R)-EYFP (200 µl at titer ≥ 1×10¹³ vg/mL, #26973-AAV9, Addgene, MA, USA) into the OB and the retrograde virus AAVrg-CamKIIα-mCherry (80 µl at titer ≥ 7×10¹² vg/mL ...
-
High-performance GPCR optogenetics based on molecular properties of animal opsins, MosOpn3 and LamPPbioRxiv - Biochemistry 2022Quote: ... The vector backbone containing SL1 and GFP was obtained by digestion of the plasmid [pEM1 = flp-21::LoxPStopLoxP::npr-1 SL2 GFP] (Addgene plasmid # 24033)65 with NotI and KpnI ...
-
bioRxiv - Developmental Biology 2021Quote: The pU6-chiRNA:sgRNA plasmid was obtained by incorporating the sgRNA sequence (obtained by annealing phos-gRNA-F and phos-gRNA-R, Supplementary Table 1) into pU6- BbsI-chiRNA (Addgene plasmid # 45946) (22 ...
-
bioRxiv - Neuroscience 2020Quote: ... CRISPR guide RNA sequences (sgRNA#1 TTGTTGCCCAGGGTTTAACA and sgRNA#2 CCCATCCCCGGCACCGGGTC) targeting the mouse Nlk locus were cloned into pSpCas9n(BB)-2A-Puro (Addgene #62987; PX462). Cells were transfected with gRNA and Cas9n-expressing plasmids using Lipofectamine 2000 and successfully transfected cells were selected with 3μg ml-1 puromycin for two days ...
-
bioRxiv - Neuroscience 2021Quote: ... the adeno-associated virus AAV2/1-Syn-FLEX-mRuby2-CSG-P2A-GCaMP6m-WPRE-SV40 (titer: 2.9 x 1013 GC per ml, Addgene accession no. 102816) in combination with AAV2/1.CamKII0.4.Cre.SV40 (titer ...
-
bioRxiv - Cell Biology 2022Quote: ... we first generated a doxycycline-inducible Cas9-expressing THP-1 cell line (iCas9-expressing cells) by transducing THP-1 cells with lentiviruses carrying the Lenti-iCas9-neo plasmid (a gift from Qin Yan; Addgene plasmid #85400). Multiple guide RNAs targeting a gene were cloned into the Lenti-multi-Guide plasmid (a gift from Qin Yan ...
-
bioRxiv - Cancer Biology 2022Quote: ... Plasmid pENTR223-1 GCN2 (NM_001013703) was purchased from Transomic Technologies and pLX303 was a gift from David Root (Addgene plasmid # 25897, RRID:Addgene_25897). GCN2 coding sequence was subcloned into the lentiviral vector pLVX-IRES-Hygromycin (Clontech ...
-
bioRxiv - Developmental Biology 2019Quote: A ROSA26 knock-in vector was constructed by insertion of CAG-Venus-IRES Pac gene expression cassette (Khoa et al., 2016) into the entry site of pROSA26-1 vector (kindly gifted from Philippe Soriano, Addgene plasmid # 21714) (Soriano ...
-
bioRxiv - Cell Biology 2020Quote: ... pENTR-backbone was created by treating pENTR-Luc (w158-1, a gift from Drs. Eric Campeau and Paul Kaufman; Addgene plasmid #17473) with NcoI and XbaI (New England Biolabs ...
-
bioRxiv - Genetics 2020Quote: ... BLRR was then transferred to pLenti CMV Puro DEST (w118-1)(33) (a kind gift from Eric Campeau & Paul Kaufman; Addgene plasmid #17452) from pENTR-BLRR using Gateway LR Clonase II Enzyme mix (111791020 ...
-
bioRxiv - Molecular Biology 2021Quote: ... HEK293T cells were plated at 2.2 x 105 ml−1 and transfected the following day with shRNA-expressing plasmid (shSp7 or shLacZ plasmid) along with psPAX2 (Addgene, plasmid 12260) and pMD2.G (Addgene ...