Labshake search
Citations for Addgene :
1751 - 1800 of 2227 citations for 8 phenylamino 5 4 5 sulpho 1 naphthyl azo 1 naphthyl azo naphthalene 1 sulphonic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2024Quote: ... pFA6a-link-yoEGFP-SpHis5 (primers OM-8 and OM-9) (Addgene plasmid #44836), and pBTK522::FAST-PETase 21 (gift from Hal Alper ...
-
bioRxiv - Neuroscience 2023Quote: ... was injected AAV1.Syn-GCaMP6m (pAAV.Syn.GCaMP6m.WPRE.SV40 from Addgene, #100841, titer 6-8 ✕ 1012). To express tdTomato in GABAergic neurons ...
-
bioRxiv - Plant Biology 2019Quote: ... DNA-oligonucleotides (Figure 2-source data 1) containing the specific gRNA sequence were synthesised and used to amplify the full gRNA from a template plasmid (AddGene #46966). Using Golden Gate cloning40 each gRNA was then recombined in a L1 vector downstream of U6 promoter39 ...
-
bioRxiv - Cell Biology 2020Quote: FACS EPCAM+ stromal depleted organoids at d14 were infected with lentivirus at an estimated MOI of 0.9 according to Van Lidth de Jeude et al.72 with third generation lentiviral vectors (PGK-GFP T2A Puro, SBI cat# CD550A-1; mCherry modified from pLentiCRISPRv1 (Addgene #49545) to incorporate an EF-1a-mCherry P2A Puro cassette ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Site-directed integration into attP sites was achieved by co-injection of an attB-containing vector (400 ng µl-1) and pBS130 (encoding phiC31 integrase under control of a heat shock promoter (Addgene #26290) [73]) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The first fragment was amplified using p15-Cam-F and p15-Cam-R (Table 1) from the plasmid pEVOL-pBpF (Addgene #31190), and the second fragment was obtained from the pBAD/HisB vector (Invitrogen ...
-
bioRxiv - Biophysics 2022Quote: ... NCBI Accession YP_009820873.1) were cloned with an N-terminal TEV protease-cleavable His6-tag using UC Berkeley Macrolab vector 2-BT (Addgene #29666). Truncations and other modified constructs were cloned by PCR mutagenesis and isothermal assembly ...
-
Rab35 Governs Apicobasal Polarity Through Regulation of Actin Dynamics During Sprouting AngiogenesisbioRxiv - Developmental Biology 2022Quote: ... and Linearized pShuttle-CMV plasmids were transformed into the final viral backbone using electrocompetent AdEasier-1 cells (gift from Bert Vogelstein; Addgene, #16399). Successful incorporation of pShuttle-CMV construct into AdEasier-1 cells confirmed via digestion with PacI (ThermoFisher) ...
-
bioRxiv - Physiology 2019Quote: ... pLKO.1 scrambled shRNA or Sirt4 shRNA was transfected in HEK293 T cells with packaging plasmids pMD2.G (Addgene plasmid # 12259) and psPAX2 (Addgene plasmid # 12260) ...
-
bioRxiv - Developmental Biology 2019Quote: ... using AscI and NotI-containing primers and cloned the fragment into the vector p-attB-min.hsp70P-FRT-STOP#1-FRT-DamMyc[open] (Addgene plasmid #71809). Transgenic lines were generated by Genetivision Inc ...
-
bioRxiv - Cell Biology 2019Quote: ... Two gRNA sequences targeting different regions of linc00899 (guide 1 and 2) were cloned into pU6-sgRNA EF1Alpha-puro-T2A-BFP (Addgene, #60955). All clones were verified by Sanger sequencing using mU6 forward primers (Supplementary Methods) ...
-
bioRxiv - Cell Biology 2020Quote: Knockdown of TPM1 was performed using the pLKO.1 plasmid lentiviral backbone (a kind gift from Bob Weinberg, Addgene plasmid #8453) either encoding an shRNA with sequence complementary to TPM1 (shTPM1 ...
-
bioRxiv - Bioengineering 2021Quote: ... The nCas9(D10A) was generated by the PCR method using previously optimized Cas9 as a template (Level 1 hCas9 module, Addgene #49771). Desired sgRNA sequence was PCR amplified using plasmid pICH86966::AtU6p::sgRNA_PDS (Addgene #46966 ...
-
bioRxiv - Cancer Biology 2020Quote: ... a sox10 minimal promoter was PCR amplified from genomic DNA from AB* larvae with primers (Table 1 and 2) containing overlapping nucleotides to sequences on either side of the AgeI site in pENTR-EGFP2 (Addgene #22450), similarly described in (Quillien et al. ...
-
bioRxiv - Cancer Biology 2019Quote: shRNA targeting sequences from the RNAi consortium (102) were cloned into tet-pLKO.1-puro as previously described (38) for shLuc (TRCN0000072250, Addgene #136587), shNRF2 #1 (TRCN0000281950 ...
-
bioRxiv - Cell Biology 2021Quote: The components for each of the individual optogenetic sensors were first assembled in Level 1 destination vectors included in the MoClo Toolkit (Addgene #1000000044) by Golden Gate (GG ...
-
bioRxiv - Biochemistry 2021Quote: Expression cassette comprising of genes encoding PEPCK along with 1 kb of its promoter was cloned into pIB3 vector (cat # 25452, Addgene, USA) and expressed in P ...
-
bioRxiv - Cell Biology 2021Quote: ... Mito-mCh-1×FLAG and Mito-mCh-smFLAG were constructed by ligating 1×FLAG synthesized by overlapping PCR and smFLAG amplified from smFLAG-KDM5B-24×MS2 (Addgene # 81084) with previously built Mito-mCh-1×HA cut by BglII and BamHI through Gibson Assembly.
-
bioRxiv - Cell Biology 2021Quote: ... U2OS cells seeded on 35mm MatTek chambers with 70% confluency were loaded with 1 µg of smFLAG-KDM5B-24×MS2 (Addgene #81084), 0.5 µg of anti-FLAG FB-GFP and 130 ng of purified MCP-HaloTag protein by bead loading (Cialek et al. ...
-
bioRxiv - Cell Biology 2021Quote: A codon-optimised sequence for full-length USP7 (USP7FL) was cloned into pGEX6p-1 using BamHI/NotI restriction sites (Addgene, #63573). Mutations at S18 were introduced using partially overlapping primers with Phusion Flash polymerase (Thermo Fisher Scientific) ...
-
bioRxiv - Systems Biology 2020Quote: ... We then used lentivirus to stably integrate pCMV-DHB-mCherry or pCMV-mCherry-Geminin(1-110)-P2A-mCitrine-Cdt1(30-120) in pLenti-Puro (Addgene: 39481). Cells were screened with puromycin and sorted by FACS to generate monoclonal cell lines.
-
bioRxiv - Neuroscience 2020Quote: Cortical pyramidal neurons (CPN)s in WT and YAC128 cultures were labeled by transfecting a subset of neurons (1 of 2.7 million) with a cytoplasmic green fluorescent protein (GFP) (Addgene plasmid 37825) at the time of platting ...
-
bioRxiv - Genomics 2021Quote: ... Corresponding DNA oligonucleotides with BbsI overhangs (sequences are listed in Suppl. Table 1) were annealed and ligated with pre-digested pSPgRNA plasmid (Addgene, # 47108). HEK293T17 cells (ATCC ...
-
bioRxiv - Neuroscience 2019Quote: ... Expression of soma-targeted-ChrimsonR was achieved by stereotaxic injection of AAV serotype 1 carrying ChrimsonR-EYFP fused to a Kv2.1 somatic lo alization motif (“fle - ChrimsonR-EYFP-kv”, Addgene plasmid #135319). Injections were made into right visual cortex of mice aged between P26-P53 ...
-
bioRxiv - Neuroscience 2021Quote: Voltron2 and Channelrhodopsin2 were expressed throughout the motor cortex using injections of a mixture of (1) rAAVretro-hSyn-Cre-WPRE (2×109 g.c.; Addgene #105553-AAVrg), (2 ...
-
bioRxiv - Molecular Biology 2022Quote: FLAG-NKX2-1 or FLAG-GFP open reading frame (ORF) was cloned into pLEX_306 (a gift from David Root, Addgene plasmid #41391). Cells stably expressing Cas9 were generated by infection with the lentiCas9-Blast plasmid (Addgene # 52962 ...
-
bioRxiv - Cell Biology 2022Quote: ... The Capping Protein (F-actin-capping protein subunit alpha-1 and F-actin-capping protein subunit beta) plasmid was a gift from Antoine Jégou & Guillaume Romet-Lemonne (Addgene plasmid #89950).
-
bioRxiv - Cancer Biology 2022Quote: ... The double strand DNA coding HMGN5 shRNA and STAT3 shRNA were synthesized by Sangon Biotech (Shanghai, China) and cloned into the lentiviral vector pLKO.1-Puro (Addgene, 8453).
-
bioRxiv - Immunology 2022Quote: Lentiviruses pseudotyped with HIV-1 env were prepared by transfecting the Lenti-X 293T cells with pCMV-dR8.3 Δvpr (Addgene plasmid #8455), pLOX-CW-tdTomato ...
-
bioRxiv - Microbiology 2021Quote: ... hairpin loop sequence and shRNA sequence were synthesised (IDT technologies) and annealed oligos cloned into pLKO.1 TRC cloning vector (Addgene #10878) using the unique Age1/EcoR1 sites ...
-
bioRxiv - Neuroscience 2020Quote: Plasmid Cry2olig-mCherry-tau 1-441 was prepared by inserting DNA fragment encoding the full length tau into the linearized Cry2olig-mCherry (Addgene 60032) backbone at the C-terminus of mCherry using Gibson assembly® Cloning kit (New England BioLab Int.) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The annealed oligos were diluted (1:200) and cloned into pLV hU6-sgRNA hUbC-dCas9-KRAB-T2a-Puro (encoding dCas9-KRAB; Addgene # 71236) using a Golden Gate Assembly strategy (containing ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tetracycline-inducible TET-shRB1 and constitutive shRB1 constructs were created by integrating validated siRNA sequences GAAAGGACATGTGAACTTA (63) and GAACGATTATCCATTCAAA (64) targeting human RB1 (shRB1) into TET-pLKO.1-Puro vector (Addgene #21915) and pLKO.1-Puro vector ...
-
bioRxiv - Cancer Biology 2021Quote: ... plasmids were created by integrating validated siRNA sequences CCTGTCAGGAAACTGTATGAT (62) and AATGGCCATCAGAACGGACTT targeting human ESRRG (shESRRG) into pLKO.1-Puro vector (Addgene #8453). Non-specific siRNA sequence AACAGCCACAACGTCTATATC or siRNA sequence CAACAGCCACAACGTCTATAT targeting GFP were used as controls for shRNA ...
-
bioRxiv - Neuroscience 2021Quote: ... HEK293T cells were transfected using Fugene HD transfection reagent in a 3:1 reagent : DNA ratio with packaging plasmid 2 µg psPAX2 (a gift from Didier Trono, Addgene, #12260), 1 µg murine ecotropic envelope plasmid pEnv(eco)-IRES-puro (Morita et al ...
-
bioRxiv - Neuroscience 2021Quote: ... Twenty hemizygous ChAT-Cre mice were bilaterally injected with Cre-dependent inhibitory DREADD fused with mCherry reporter AAV8-hsyn-DIO-hM4Di-mCherry (1×1013 VG/ml; Addgene, 44362) or control virus (AAV8-hsyn-DIO-mCherry ...
-
bioRxiv - Cancer Biology 2022Quote: The human NOTCH 1 intracellular domain (h1NICD) doxycycline-inducible expression plasmid (pLIX-h1NICD) was a gift from Julien Sage (Addgene #91897)11 ...
-
bioRxiv - Immunology 2022Quote: ... Vector psPAX2 containing the untagged coding sequence for HIV-1 gag-pol was a gift from Didier Trono (Addgene plasmid # 12260).
-
bioRxiv - Cell Biology 2022Quote: All shRNA were generated by ligation of oligos into AgeI and EcoRI of pLKO.1 (Addgene plasmid #8453; Addgene, Teddington, UK). Lower case sequences represent the targeted sequences.
-
bioRxiv - Cell Biology 2022Quote: All shRNA were generated by ligation of oligos into AgeI and EcoRI of pLKO.1 (Addgene plasmid #8453; Addgene, Teddington, UK). Lower case sequences represent the targeted sequences.
-
bioRxiv - Systems Biology 2019Quote: P(dat-1)::YFP and P(dat-1)::alpha-Synuclein-YFP were generated by cloning the P(dat-1) promoter in the plasmids pRP2386 28 and pPD30.38 (Addgene plasmid # 1443) respectively ...
-
bioRxiv - Molecular Biology 2019Quote: The gene encoding full length Francisella novicida (Fn) Cas9 nuclease residues 1-1629 bp) was PCR amplified using PX408 (Addgene 68705) as a template and cloned in pET28-His-10-Smt3 vector (a kind gift from Prof ...
-
bioRxiv - Cancer Biology 2020Quote: shRNA targeting CDK9 was cloned into pLKO.1 lentiviral vector (Sequence: Forward: CCGGGTTCGACTTCTGCGAGCATGACTCGAGTCATGCTCGCAGAAGTCGAACTTTTG Reverse:AATTCAAAAAGTTCGACTTCTGCGAGCATGACTCGAGTCATGCTCGCAGAA GTCGAC. Luciferase vector was purchased from Addgene (plasmid #17477). Recombinant lentiviral vector and packaging vector (pCMV-dR8.9 and pMD2.G-VSVG ...
-
bioRxiv - Genetics 2019Quote: ... were ordered from Integrated DNA Technologies and after phosphorylation and annealing were cloned into pLKO.1 - TRC shRNA cloning vector (Addgene #10878) into AgeI/EcoRI site ...
-
bioRxiv - Neuroscience 2019Quote: ... The donor plasmid for homologous recombination was constructed by using a Golden Gate assembly [92] to recombine four DNA elements: 1) A backbone with ampicillin resistance (pBS-GGAC-ATGC plasmid (a gift from Frank Schnorrer, Addgene #60949)[93] ...
-
bioRxiv - Cell Biology 2020Quote: Oligo duplexes containing a single guide (sg)RNA sequence for ACLY (as shown in Figure 1-figure supplement 1A) were inserted into pCas9(BB)-2A-GFP (a gift from Feng Zhang, Addgene #48138) following the published procedures (Ran et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... Nfia/bxlox/lox;Sun1-sGFP and GLASTCreERT2;Sun1-sGFP control mice were intravitreally injected with 1 μl of AAV9-pCAG-Flex-Tdtomato (Addgene #28306) at 1×10¹³ vg/mL and treated with Tamoxifen diet for 3 weeks ...
-
bioRxiv - Cell Biology 2020Quote: The Fucci reporter construct (pLL3.7m-Clover-Geminin(1-110)-IRES-mKO2-Cdt(30-120)) was a gift from Michael Lin (Addgene plasmid #83841)35 ...
-
bioRxiv - Immunology 2021Quote: ... HEK293T cells were seeded in 6-well plates and the next day transfected with 1 μg psPAX2 packaging plasmid (Addgene 12260), 500 ng pMD2.G VSV-G envelope plasmid (Addgene 12259 ...
-
bioRxiv - Genomics 2019Quote: ... shRNAs against KAP1 (shKAP1-B and shKAP1-D) were cloned into the pLKO.1.puro vector obtained from Addgene (http://www.addgene.org) using AgeI and EcoRI sites ...