Labshake search
Citations for Addgene :
1801 - 1850 of 3325 citations for 6H 1 3 Thiazin 6 one 2 ethoxy 4 hydroxy 5 nitro 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2024Quote: ... individual single and 3-plex crRNA constructs were cloned into the human U6 promoter-driven expression vector pRG212 (Addgene 149722, originally from 29). Library1 ...
-
bioRxiv - Neuroscience 2021Quote: ... a 1:1 mixture of AAV9-hSyn-Cre (1:40000 dilution, Addgene: 105553-AAV9, titer: 3.3×1013vg/ml) and AAV1-Syn-FLEX-GCaMP6s (Addgene ...
-
bioRxiv - Neuroscience 2022Quote: ... 0.7-1 μL of virus (AAV2-CMV-mCreb, 1×1012 Addgene Plasmid #68551 ...
-
bioRxiv - Neuroscience 2020Quote: ... AAVrg-pCAG-FLEX-tdTomato-WPRE (Titer ≥ 1×1013 vg.mL−1, Addgene), CAV-2 Cre (Titer ≥ 2.5×1011 pp ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1-160 and 1-220 were cloned in pEBG-GST (Addgene). The vector expressing eGFP was described previously (49) ...
-
bioRxiv - Neuroscience 2024Quote: ... were injected a 1:1 mixture of pAAV.Syn.GCaMP6f.WPRE.SV40 (Addgene, stock #100837) virus and pAAV.CAG.LSL.tdTomato (Addgene ...
-
bioRxiv - Neuroscience 2022Quote: ... 90ul cells suspension containing 1M cells was mixed with 10 uL DNA mix: 4 ug pSpCas9(BB)-2A-Puro (PX459) plasmid (Addgene #48139), • 0.4 ug gRNA encoding plasmid (pKLV-U6gRNA(BbsI)-PGKzeo2ABFP ...
-
bioRxiv - Immunology 2019Quote: ... or VPR WT or a Q65R VPR mutant were produced through co-transfection of 293T cells with 4 plasmids coding for Gag/Pol (Addgene #12251), Rev (Addgene #12253) ...
-
bioRxiv - Molecular Biology 2021Quote: We performed a genome-wide CRISPR knock-out (KO) screen using the lentiviral Brie sgRNA library comprising 4 sgRNAs per protein-coding gene (Addgene #73632) (Doench et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... the fibroblasts were reprogrammed using the three plasmids (pCXLE-hOct3/4 [Addgene #27076], pCXLE-hSK [Addgene #27078], pCXLE-hUL [Addgene #27080]) with 10ug of each plasmid through the Amaxa Nucleofector (Lonza) ...
-
bioRxiv - Neuroscience 2020Quote: ... the fibroblasts were reprogrammed using the three plasmids (pCXLE-hOct3/4 [Addgene #27076], pCXLE-hSK [Addgene #27078], pCXLE-hUL [Addgene #27080]) with 10ug of each plasmid through the Amaxa Nucleofector (Lonza) ...
-
bioRxiv - Neuroscience 2021Quote: ... The patient-specific iPSCs were generated from LCLs by transfection with a combination of episomal plasmids (pCE-hOCT3/4, pCE-hSK, pCE-hUL, and pCE-mp53DD) (Addgene Inc.), as previously reported (Barrett et al ...
-
bioRxiv - Biophysics 2020Quote: ... A homozygous clone that passed all QC (U2OS HP1⍺ 4) was co-transfected with the transposon vector pEF1a-OsTIR-IRES-NEO-pA-T2BH (Addgene 127910) and SB100X in pCAG globin pA (Addgene 127909) ...
-
bioRxiv - Biochemistry 2022Quote: ... All plasmids generated by this study have been deposited to Addgene for distribution (See Supplemental Table 4 for Addgene accession numbers).
-
bioRxiv - Neuroscience 2021Quote: HEK293 cells were transfected with 500 ng of equimolar pooled SCN1A_h1b sgRNAs (Table 4) and 500 ng dCas9p300Core (Addgene, plasmid #61357) using Lipofectamine 3000 ...
-
bioRxiv - Microbiology 2019Quote: ... and at 28°C for 4 hours if using a temperature-sensitive plasmid (pIMAY, gift from Tim Foster, Addgene plasmid # 68939) (Lee et al. ...
-
bioRxiv - Developmental Biology 2022Quote: ... 35 μl of hot glycerol was cooled to 4°C then 35 μl of the primer mixture and 25 μl of Tn5 (Addgene #112112) was added and mixed and held at 1 hr at RT with gentle pipet mixing every 15 min ...
-
bioRxiv - Cell Biology 2022Quote: ... Retrovirus expressing NFAT1-GFP was constructed by inserting BglII/HpaI NFAT1-GFP fragment from HA-NFAT1(4-460)-GFP plasmid (Addgene #11107) into BglII/HpaI sites of pMSCV-Blasticidin plasmid (addgene #75085 ...
-
bioRxiv - Cell Biology 2024Quote: ... The hDLXI56i enhancer was originally obtained from CN1851-rAAV-hI56i-minBglobin-iCre-4×2C-WPRE3-BGHpA (Graybuck et al., 2021) (Addgene #164450).
-
bioRxiv - Neuroscience 2023Quote: ... we generated small guide RNAs to PAM sites in proximity to exons 4 and 7 of the murine Grik3 locus and cloned these into the pSpCas9(BB)-2A-GFP (PX458) backbone (Addgene #48138), where expression of the sgRNAs is controlled under the U6 promoter ...
-
bioRxiv - Cancer Biology 2023Quote: ... they were transduced with lentivirus containing pLenti_CMV_GFP_Hygro [pLenti CMV GFP Hygro (656-4) was a gift from Eric Campeau & Paul Kaufman (Addgene viral prep #17446-LV)] at a multiplicity of infection of 10 for 48 hours before washing with PBS and replacing with fresh medium ...
-
bioRxiv - Molecular Biology 2024Quote: ... The sensing domain for citrate comprised residues 4–133 of the CitAP domain from Klebsiella pneumoniae CitA protein (Addgene plasmid #134301). The sensing domain for glucose comprised residues 24–328 of the bacterial D-galactose-binding periplasmic protein (MglB ...
-
bioRxiv - Developmental Biology 2020Quote: The zebrafish gfap promoter 51 was derived from the Addgene plasmid: pEGFP-gfap(Intron1/5’/Exon1-zebrafish) (Addgene, #39761) and lssmKate2 65 was derived from the Addgene plasmid ...
-
bioRxiv - Bioengineering 2022Quote: ... and LT1 (305 μL) was combined with a DNA mixture of the packaging plasmid pCMV_VSVG (Addgene 8454, 5 μg), psPAX2 (Addgene 12260 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Addgene plasmid # 12456) and 5 ng of Renilla luciferase control plasmid (a gift from David Bartel; Addgene plasmid # 12179) in each well ...
-
Loss of TREM2 reduces hyperactivation of progranulin deficient microglia but not lysosomal pathologybioRxiv - Neuroscience 2021Quote: ... and 5 mg sgRNA cloned into the BsmBI restriction site of the MLM3636 plasmid (gift from Keith Joung, Addgene plasmid #43860 ...
-
bioRxiv - Cell Biology 2021Quote: Embryonic fibroblasts were generated from RHBDL4 WT and RHBDL4 KO E14.5 embryos and immortalized using lentiviral transduction of SV40 virus large T antigen (Ef1a_Large T-antigen_Ires_Puro, Addgene plasmid 18922), as described by Christova et al ...
-
bioRxiv - Neuroscience 2022Quote: ... and 210nl of Arch 3.0- eYFP (rAAV2-EF1a-double floxed-eArch3.0-eYFP; 5 × 1011 GC per ml; UNC Vector Core or eYFP (Addgene plasmid 20296 ...
-
bioRxiv - Cell Biology 2019Quote: ... All gRNA plasmids were generated with primers listed in Supplementary Table 5 (IDT) and integrated into pX330 (Addgene #42230) vector using Zhang Lab General Cloning Protocol 29 ...
-
bioRxiv - Genetics 2019Quote: ... Vector pZZ113 containing sgRNA expression cassette against cbr-dpy-5 was derived from PU6∷unc-119_sgRNA (Addgene plasmid # 46169) as described (Friedland et al. ...
-
bioRxiv - Neuroscience 2021Quote: Four mice (experimental group) were stereotactically injected in the DR with AAV2/5-EF1α-DIO-ChR2-WPRE-eYFP (Addgene viral prep 20298-AAV5 ...
-
bioRxiv - Cancer Biology 2022Quote: ... This middle entry vector was Gateway recombined using a 5’ entry zebrafish ubiquitious promoter (Addgene #2732, Watertown, MA, USA), a 3’ entry pA vector ...
-
bioRxiv - Molecular Biology 2023Quote: ... The CasX2 ORF was amplified from pBLO 62.5 (pBLO 62.5 was a gift from Jennifer Doudna and Benjamin Oakes, Addgene plasmid #123124; http://n2t.net/addgene:123124; RRID:Addgene 123124) [39] ...
-
bioRxiv - Neuroscience 2023Quote: A volume of 200 nL of pGP-AAV2/5-syn-FLEX-jGCaMP8m-WPRE (1.9×1012 pp/mL, Addgene; #162378) expressing the genetically encoded calcium indicator GcaMP8m was injected into the CA2 region of the right hemisphere at AP -2.0 mm ...
-
bioRxiv - Genetics 2023Quote: ... a pDestTol2CG2-eye-bfp with the independent marker beta-crystaline:BFP a kdrl P-5’entry clone (Addgene, Santoro Lab), an EGFP-CAAX p-middle entry (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: ... we injected the Cre-dependent constructs AAV-EF1a-DIO-ChrimsonR-mRuby2-KV2.1-WPRE-SV40 (5×1011 gc/mL; Addgene) and AAV-EF1a-DIO-eNpHR3.0-mCherry-WPRE (5×1012 gc/mL ...
-
bioRxiv - Neuroscience 2023Quote: ... Cre-expressing BNST neurons were induced to express eYFP (AAV-EF1a-DIO-eYFP; serotype 5; Dr. Karl Deisseroth; Addgene_27056) for visualization of BNST AVP neurons.
-
bioRxiv - Cancer Biology 2024Quote: ... The top 5 crRNA spacer sequences were selected and cloned into the pX459v2 Cas9 Puro Plasmid (Addgene Plasmid #62988) using single-step golden-gate cloning ...
-
bioRxiv - Neuroscience 2024Quote: TRAP2 mice were bilaterally injected in the VTA with 0.3 μl of rAAV-hSyn-DIO-hM3Dq-mCherry (5 × 1012 gc/ml; Addgene), rAAV-hSyn-DIO-hM4Di-mCherry (4.2 × 1012 gc/ml ...
-
bioRxiv - Neuroscience 2024Quote: ... we injected AAV2/5-hSyn-hM4D(Gi)-mCherry (titer: 1.05*1012 gc/ml; a gift from Bryan Roth (Addgene viral prep # 50475-AAV5 ...
-
bioRxiv - Developmental Biology 2019Quote: ... Injection mixes with a total volume of 50 μl were prepared in milliQ H2O and contained a combination of 30-50 ng/μl Peft-3::cas9 (46168; Addgene; Friedland et al., 2013), 50-100 ng/μl Pu6::sgRNA with sequences targeted against pop-1 or rnt-1 ...
-
bioRxiv - Neuroscience 2022Quote: ... A pulled glass pipette attached to a 10μl Hamilton syringe was backfilled with a solution containing a viral construct carrying gCaMP7f (AAV1-syn-jGCaMP7f-WPRE, titer 3×1013 gc/mL Addgene cat no 104488-AAV1). To reach the appropriate titer ...
-
bioRxiv - Bioengineering 2024Quote: ... Double-cysteine substitution variants of DoubleCatcher were derived from pDEST14-SpyCatcher003-(GSG)3-SpyCatcher003-TEVs-SpyTag003DA by Gibson assembly: DoubleCatcher α-Lock (GenBank and Addgene deposition in progress), DoubleCatcher β-Lock (GenBank and Addgene deposition in progress) ...
-
bioRxiv - Bioengineering 2023Quote: Full length plasmid of PI3KCA (phosphatidylinositol-4,5-biphosphate 3-kinase catalytic subunit alpha, NM_006218.4) was purchased from Addgene (Plasmid ID: 81736, Hahn and Root Lab). The coding sequence of PI3KCA was cloned into Lenti-PCDH-EF1-mNeonGreen-MCS-T2A-puromycin plasmid (a kind gift from Fırat-Karalar Lab ...
-
bioRxiv - Immunology 2021Quote: ... the human CRISPR 2-plasmid activation pooled library (SAM) was a gift from Feng Zhang (Addgene #1000000078) and used for CRISPR activation screening ...
-
bioRxiv - Synthetic Biology 2020Quote: ... targeting the LMNB1 gene (GGGGTCGCAGTCGCCATGGC) (2 ug) and an LMNB1-mEGFP containing repair vector (Addgene plasmid #87422) (3 μg ...
-
bioRxiv - Microbiology 2021Quote: ... The SARS-CoV-2 S-mEmerald construct was made by cloning the mEmerald sequence (Addgene, Plasmid #53976) to the C-terminal end of the SARS CoV-2 S-protein in the pCG expression vector ...
-
bioRxiv - Neuroscience 2020Quote: kn-p65AD was generated by co-injecting pBS-KS-attB2-SA(2)-T2A-p65AD-Hsp70 (Addgene #62915) and ΦC31 into the embryos of MI15480 (BL61064) ...
-
bioRxiv - Cancer Biology 2021Quote: Guide RNAs for TP53 and SETD2 were constructed and cloned into lenti CRISPR v-2 (Addgene, 52961) according to the original online protocol of the Zhang lab (http://www.genome-engineering.org/crispr/wp-content/uploads/2014/05/CRISPR-Reagent-Description-Rev20140509.pdf) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and 0.5 μg of SARS-CoV-2 Spike plasmid (a gift from Fang Li, Addgene plasmid #145032) using Lipofectamine 3000 transfection reagent (Invitrogen ...