Labshake search
Citations for Addgene :
1651 - 1700 of 3325 citations for 6H 1 3 Thiazin 6 one 2 ethoxy 4 hydroxy 5 nitro 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2023Quote: ... pSL832 [phlh-3::nls::gfp lacZ] was created by amplifying nls::gfp::LacZ from pPD96.04 (a gift from Andrew Fire, Addgene plasmid # 1502) and inserting this amplicon into a pSL780 backbone (phlh-3::lifeact::mKate2) ...
-
Neural mechanisms underlying uninstructed orofacial movements during reward-based learning behaviorsbioRxiv - Neuroscience 2023Quote: ... 5’-AAACTCCACTCTCTTAGGGAATACCC-3’) were ligated into a plasmid pX601-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA;U6::BsaI-sgRNA (pX601, Addgene #61591) digested with BsaI (R0535 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The well was co-transfected with 250 ng of a level 3 vector containing a construct of interest and 125 ng of BxB1 expression plasmid (Addgene #51271) using JetPrime (VWR) ...
-
bioRxiv - Systems Biology 2023Quote: The CRISPRi Calu-3 cell line was generated by lentiviral delivery of pMH0001 (UCOE-SFFV-dCas9-BFP-KRAB) (19) (Addgene #85969) into Calu-3 cells ...
-
bioRxiv - Genomics 2023Quote: sgRNAs targeting 3 different locations in the genome were cloned into a modified version of pU6-sgRNA EF1Alpha-puro-T2A-BFP (Addgene, #60955), where BFP was replaced by superfolder GFP (sfGFP ...
-
bioRxiv - Genomics 2023Quote: ... and flanking regions of respective ER localized proteins were inserted into a backbone containing a UCOE-EF-1α promoter and a 3′ WPRE element (Addgene #135448) (Jost et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... The vector V2 CRISPR DNA Plasmid (1ug) was co-transfected in 293T cells along with 3 µg of the viral envelope PMD2 (Addgene # 12259) and 4 µg of the viral packing PsPAX (Addgene #12260 ...
-
bioRxiv - Cell Biology 2023Quote: ... NT#3-TTGGATGGGAAGTTCACCCCG) or IP3R1-targeting shRNA (ULTRA3316782- TTTCTTGATCACTTCCACCAG) were packaged as lentiviral particles using packaging (pCMV- dR8.2 dpvr, Addgene, plasmid #8455) and envelope vectors (pCMV-VSV-G ...
-
bioRxiv - Cell Biology 2023Quote: ... we used the SINAPs plasmid from the Singer lab (Addgene #84561)44 and a tdTomato-FL2 (containing the 3’UTR of FL2) plasmid previously cloned in-house using the tdTomato-C1 vector (Addgene #54653), a human FL2 clone in pANT7_cGST (DNASU ...
-
bioRxiv - Biochemistry 2023Quote: ... or the control vector, or sgRNA vectors targeting human PML exon 3 (sense: CACCGGcggtaccagcgcgactacg, antisense: AAACcgtagtcgcgctggtaccgCC) inserted in pLentiV2 vector (Addgene, 52961) along with pMD2.G and psPAX into 293T cells ...
-
bioRxiv - Bioengineering 2023Quote: ... is based on Addgene 12150770. AAV-sgmir96-Master (Supplementary Fig. 3) is based on pAAV-U6-sgRNA-CMV-GFP (Addgene 85451)71 ...
-
bioRxiv - Cancer Biology 2023Quote: Two sets of gRNAs targeting either exon 3 or exon3-7 of IL1R1 coding region were cloned in PX459 (Addgene 62988) and co-transfected in HT1080 cells ...
-
bioRxiv - Cell Biology 2024Quote: ... 5’-CAC CGG GAG CAT TTG CGC TTG CGG C-3’ and 5’-AAA CGC CGC AAG CGC AAA TGC TCC C-3’ comprising the VPS35 guide RNA were annealed and inserted into the pLentiCRISPRv2 (Addgene, 49535) vector ...
-
bioRxiv - Cell Biology 2024Quote: ... 5’-CAC CGT TCA TAC CTC AAG CGG ACA T-3’ and 5’-AAA CAT GTC CGC TTG AGG TAT GAA C-3’ comprising the VPS26 guide RNA were annealed and introduced into pLentiCRISPRv2 hygro (Addgene, 98291). Lentivirus was produced as described above and transduced into VPS35 KO cells ...
-
bioRxiv - Systems Biology 2022Quote: ... we first prepare the vector backbone by incubating 5 ug of PB-TRE-dCas9-VPR (Addgene #63800) for 2 h at 37°C with 2 ul of FastDigest FspAI (ThermoFisher cat ...
-
bioRxiv - Neuroscience 2019Quote: Mice 5-7 weeks old received bilateral microinfusion of AAV1-CamKiia-hChR2(H134R)-mCherry.WPRE.hGH (Addgene, #26975-AAV1) layer 2/3 of the barrel cortex (−1.3mmAP ...
-
bioRxiv - Neuroscience 2022Quote: ... Cells were transduced with floxed jGCaMP7b (AAV1-syn-FLEX-jGCaMP7b-WPRE; Addgene #104493, MOI = 5×105 vg) [14] and low-titer Cre (AAV9-hSyn-Cre-WPRE-hGH ...
-
bioRxiv - Systems Biology 2022Quote: ... we prepared the vector backbone by incubating 5 ug of UCOE-SFFV-dCas9-BFP-KRAB (Addgene #85969) for 2 h at 37 °C with 2 ul of FastDigest BamHI (ThermoFisher cat ...
-
bioRxiv - Neuroscience 2022Quote: ... Circuit-specific viral expression was achieved using the retrograde properties of adeno-associated virus (AAV) serotype 5 23: AAV5.hSyn.HI.eGFP-Cre.WPRE.SV40 (Addgene; #105540). Sparse labelling was obtained using Cre-inducible ...
-
bioRxiv - Cell Biology 2020Quote: ... Animals received a single dose of AAV8.TBG.null or AAV8.TBG.p21 (5*10^12 units/ml) (Addgene) intravenously allowed 1 week wash-out period on normal diet ...
-
bioRxiv - Neuroscience 2022Quote: ... mRuby-ER-5 was a gift from Michael Davidson (Addgene plasmid #55860; http://n2t.net/addgene:55860; RRID:Addgene_55860). Matrix-roGFP (mt-roGFP ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and the first 639 bp of the 5’ end of p65HSF1 from pAC1393-pmax-NLSPUFa_p65HSF1 (Addgene, #71897). These were then Gibson assembled along with an IDT gBlock containing the last 300 bp of p65HSF1 that had been codon optimised for expression level detection distinct from endogenous mRNA ...
-
bioRxiv - Neuroscience 2023Quote: ... anesthetized RiboTag RT +/+ mice were bilaterally injected with AAV5-Cre viruses (AAV sterotype 5 AAV5.hSyn.HI.eGFP-Cre.WPRE.SV40 (Addgene; #105540) at the following coordinates ...
-
bioRxiv - Neuroscience 2023Quote: ... 400 nl of AAV2/5-CAG-dLight1.1 (1.7×1013 GC/ml, 111067-AAV5, Addgene, Watertown, MA, USA) was slowly injected into the DMS (n = 7 ...
-
bioRxiv - Genetics 2023Quote: ... the FKBP coding sequence was amplified from the PM-FRB-Cerulean-T2A-FKBP-5-ptase plasmid (Addgene 40897 ...
-
bioRxiv - Cell Biology 2023Quote: ... pLenti CMV GFP Puro (658-5) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid #17448). mito-BFP was a gift from Gia Voeltz (Addgene # 49151) ...
-
bioRxiv - Cell Biology 2023Quote: A 5’ 3xHA-Tag sequence were inserted into pMSCV-IRES-GFP II (MIG) plasmid (Addgene, Plasmid #52107;23). Human GATA2 WT ...
-
bioRxiv - Cell Biology 2023Quote: ... and the sgRNA cassettes were assembled into pGGG-M along with end linker pELE-5 (Addgene #48020). The resulting plasmids were named pGGG-ZIP4-B2 Construct 1 (containing sgRNA 4 and 12 ...
-
bioRxiv - Systems Biology 2024Quote: We established a stable Cas9-expressing line by infecting EpiSC-5 cells with lentiCas9- Blast (Addgene 52962), followed by selection with 5 µg/ml blasticidin (Sigma 15205 ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV2/5.CaMKII.tdTomato (Neurophotonics, 661-aav5) was used to label excitatory neurons and AAV9.CaMKII.GCaMP6s.WPRE.SV40 (Addgene, 107790) was employed to image excitatory neuronal calcium activity ...
-
bioRxiv - Neuroscience 2023Quote: ... RRID:Addgene_20297) or eYFP alone as a control (AAV-EF1a-DIO-eYFP; serotype 5; Dr. Karl Deisseroth; RRID:Addgene_27056).
-
bioRxiv - Cancer Biology 2024Quote: ... The pLenti-ATF4-uORF-GFP reporter plasmid was generated by placing the ATF4 5’UTR from Addgene plasmid #21850 ...
-
bioRxiv - Neuroscience 2024Quote: ... a volume of 200 nL AAV2/5.hsyn.GcaMP6f.WPRE.SV40 virus or AAV2/5.syn.jGCaMP8s.WPRE (respectively: titer: 1.3*1012 gc/mL; a gift from Douglas Kim & GENIE Project: Addgene viral prep # 100837-AAV5 ...
-
bioRxiv - Microbiology 2020Quote: The production of high titer Human sgRNA Brunello lentiviral library which contains 4 sgRNA per gene (15) (Addgene #73178), was performed by transfecting HEK293T cells in five 15 cm tissue culture plates using PEI (Polyethylenimin Linear ...
-
bioRxiv - Bioengineering 2020Quote: ... pCXLE-hMLN and pCXLE-hOCT3/4 that were a gift from Shinya Yamanaka (Addgene plasmid # 27078, 27079 and 27076), according to previously reported papers(80,81) ...
-
bioRxiv - Molecular Biology 2022Quote: ... and pMD2G envelope plasmid (4 µg, a gift from Didier Trono; Addgene plasmid #12259; http://n2t.net/addgene:12259; RRID: Addgene_12259) were transfected into HEK-293 T cells (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2022Quote: ... Most CaMKII mice (n=4) were infused with AAV9-CaMKII-SomArchon-GFP (titer: 3.2×1012 GC/mL, Addgene #126942), and one CaMKII mouse was infused with AAV9-synapsin-SomArchon-GFP (titer ...
-
bioRxiv - Systems Biology 2023Quote: ... and pMD2G envelope plasmid (4 μg, a gift from Didier Trono (Addgene plasmid #12259; http://n2t.net/addgene:12259; RRID: Addgene_12259)) were transfected into HEK-293 T cells (ThermoFisher Scientific ...
-
bioRxiv - Bioengineering 2023Quote: ... followed by addition of the plasmid cocktail containing 4 µg of pMD2.G (a gift from Didier Trono; Addgene plasmid # 12259 ...
-
bioRxiv - Microbiology 2023Quote: ... hGM-CSF and hIL-4 were produced from HEK293 cells stably transduced with pAIP-hGMCSF-co (Addgene no. 74168) or pAIP-hIL4-co (Addgene no ...
-
bioRxiv - Cell Biology 2023Quote: ... pLenti CMV GFP Hygro (656-4) was a gift from Eric Campeau and Paul Kaufman (Addgene plasmid # 17446; http://n2t.net/addgene:17446; RRID: Addgene_17446). pLenti CMV GFP Hygro (656-4 ...
-
bioRxiv - Cancer Biology 2024Quote: ... and transfected with 2.5 µg linearized RUNX1 HDR template and 4 µg each of pCW-Cas9 plasmid (Addgene, #50661) as well as two sgRNA plasmids using program CD-118 of the 4D Nucleofector system (Lonza) ...
-
bioRxiv - Neuroscience 2019Quote: ... and a 1:1 solution of AAV1.Syn.GCaMP6f.WPRE.SV40 (Addgene) and AAV1.mDlx.GFP-GCaMP6f-Fishell-2.WPRE.SV40 (Penn Vector Core ...
-
bioRxiv - Molecular Biology 2023Quote: ... and pRSFDuet-1 IntS8 AA 1-308 (Addgene #196905), respectively ...
-
bioRxiv - Neuroscience 2023Quote: ... 1:1 mixture of pENN.AAV.CamKII 0.4.Cre.SV40(AAV1; Addgene #105558 ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 2.5 ng/mL Pmyo-2::mCherry as a co-injection marker (pCFJ90, Addgene #19327). Microinjection of adult N2 hermaph-rodites was performed as described above ...
-
bioRxiv - Cell Biology 2019Quote: ... 2 μg of pSpCas9(BB)-2A-GFP (PX458) (gift from Feng Zhang, Addgene plasmid #48138) containing the FOXJ1 targeting sgRNA sequence 5’-GGGCCTTCTTGTAAGAGGCC-3’ or the CCDC40 targeting sgRNA sequence 5’-CTCCTCGTTGGCGGCTGCGCAGG-3’ with 1 μg of MBX plasmid (gift from Linzhao Cheng ...
-
bioRxiv - Bioengineering 2021Quote: ... We created 2 bacterial expression vectors: pET28-His-MBP-NLS-RfxCas13d-NLS-HA (Addgene 171586) produces the protein RfxCas13d-sTag after cleavage of the N-terminal His-MBP fusion partner ...
-
bioRxiv - Biochemistry 2021Quote: ... Individual nsp10 was expressed from plasmid SARS-CoV-2 3xFlag-nsp5CS-nsp10 (Addgene ID 169157) containing the N-terminal 3xFlag tag (MDYKDHDGDYKDHDIDYKDDDDK) ...
-
bioRxiv - Biophysics 2021Quote: The plasmid with cDNA encoding SARS-Cov-2 spike HexaPro (S) was obtained from Addgene. To express the S protein ...