Labshake search
Citations for Addgene :
1701 - 1750 of 2145 citations for Osteopontin Human OPN ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... and pAAV-mDlx-GFP-Fishell-1 (a gift from Gordon Fishell, Addgene plasmid # 83900; http://n2t.net/addgene:83900; RRID:Addgene_83900) by restriction subcloning ...
-
bioRxiv - Neuroscience 2024Quote: ... and pAAV2/1 (a gift from James M. Wilson, Addgene plasmid #112862; http://n2t.net/addgene:112862; RRID: Addgene_112862) were used for virus production ...
-
bioRxiv - Microbiology 2024Quote: ... were cloned into CMV Blast DEST (706–1) (a gift from Eric Campeau & Paul Kaufman, Addgene plasmid #17451) expression vector resulting in plasmid AX581 ...
-
bioRxiv - Cell Biology 2024Quote: The pLKO.1 – TRC cloning vector was a gift from David Root (Addgene plasmid # 10878; http://n2t.net/addgene:10878 ; RRID:Addgene_10878). The shRNA sequences were cloned into the AgeI and EcoRI sites of the plasmid using standard cloning techniques ...
-
bioRxiv - Cancer Biology 2024Quote: ... subcloning and sequencing The pLJM1-empty (#91980) and PD-1-miSFIT-1x (#124679) vectors were purchased from Addgene. PTEN and PD-1 were subcloned into linearized pLJM1-empty vector using EcoR1 and NHE1 restriction enzymes (NEB ...
-
bioRxiv - Cell Biology 2020Quote: ... and further subcloned into a CMV driven vector (pLenti CMV V5-LUC Blast (w567-1) was a gift from Eric Campeau (Addgene plasmid #21474 ; http://n2t.net/addgene:21474 ; RRID:Addgene_21474 49)) ...
-
bioRxiv - Cell Biology 2020Quote: ... and WD repeat domain phosphoinositide-interacting protein 1 (WIPI1) cDNA was a gift from Noboru Mizushima (Addgene plasmid # 38272) (Itakura & Mizushima ...
-
bioRxiv - Molecular Biology 2020Quote: ... and Gibson-assembled with the HaloTag gene amplified with primers HaloTag_F and HaloTag_R (Table 1) and pFA6a-HaloTag-KanMX6 (Addgene #87029) as a template ...
-
Mapping of the autophagosomal degradome identifies IL-7Rα as key cargo in proliferating CD4+ T-cellsbioRxiv - Immunology 2021Quote: P-Lenti CMV/TO SV40 small + Large T (w612-1) was a gift from Eric Campeau (Addgene plasmid # 22298). For packaging the virus ...
-
bioRxiv - Genomics 2020Quote: ... shINTS2 and shINTS5 were designed with the Broad Institute algorithm (https://portals.broadinstitute.org/gpp/public/) and subsequently cloned into pLKO.1 (Addgene #10879). Sequences of all shRNAs are listed in the Key Resources Table ...
-
bioRxiv - Cancer Biology 2019Quote: ... MiR-146a over-expression cassette was sub-cloned from pU61 into the pLKO.1 TRC vector (Addgene plasmid #10878). Packaging plasmids psPAX2 (Addgene plasmid # 12260 ...
-
bioRxiv - Neuroscience 2019Quote: ... the inhibitory channelrhodopsin stGtACR2 (soma-targeted Guillardia theta anion-conducting channelrhodopsin 2, pAAV_hSyn1-SIO-stGtACR2-FusionRed, titer > 1 x 1013 particles/mL, Addgene). The vectors were injected (0.5 µl each side ...
-
bioRxiv - Neuroscience 2020Quote: ... bilaterally injected using a pulled glass needle in the hippocampal area with 0.5 μL AAV-hSyn-Cre-EGFP at 3 × 1012 GC ml-1 (Addgene #105540 ...
-
bioRxiv - Bioengineering 2021Quote: ... rat TE-NSPs were incubated overnight at 5 DIV with media including 1/2000 of pAAV1.hSyn.eGFP.WPRE.bHG (final titer of ~3×1010 genomic copies/mL; Addgene, 105539-AAV1), with a full media change on the next day.
-
bioRxiv - Neuroscience 2021Quote: ... a 1:3 mixture of AAV1-CAG-mRuby3 (custom made from plasmid Addgene 107744, titer: 1.6×1012 vg/ml) and AAV1-Syn (or CAG)-FLEX-GCaMP6s (Addgene ...
-
bioRxiv - Cancer Biology 2021Quote: Mouse Trp53 transcript variant 1 (NM_011640.3) was cloned into the retroviral vector pMSCV-IRES-GFP II (Addgene plasmid #52107). Trp53 point mutations were introduced using site-directed mutagenesis with the Q5 Site-Directed Mutagenesis Kit (New England Biolabs E0552S) ...
-
bioRxiv - Biochemistry 2021Quote: Gene encoding GFP was cloned under 1 kb promoter of GDH2 and PEPCK into pIB3 vector (Addgene plasmid #25452) and expressed in P ...
-
bioRxiv - Cell Biology 2021Quote: To generate the nrfl-1(null) deletion allele a mix containing Peft-3::Cas9 (Addgene #46168; 50 ng/μl), two pairs of sgRNA plasmids targeting the 5’ or 3’ ends of the nrfl-1 open reading frame (75 ng/μl each) ...
-
bioRxiv - Cell Biology 2021Quote: ... used for creating tetracycline-inducible cell lines were gifts from Eric Campeau (w762-1: Addgene plasmid #26434; http://n2t.net/addgene:26434; RRID: Addgene_26434 ...
-
bioRxiv - Cell Biology 2021Quote: ... and pLKO.1 puro-based plasmid harboring the designed shRNA (pCMV-VSV-G and pLKO.1 puro were a gift from Bob Weinberg, Addgene plasmid #8454; http://n2t.net/addgene:8454; RRID: Addgene_8454 ...
-
bioRxiv - Cancer Biology 2020Quote: ... pLenti CMV Puro DEST (w118-1) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid# 17452; RRID: Addgene_17452). The open reading frame for MCL1 was obtained as a gift from Dr ...
-
bioRxiv - Cancer Biology 2020Quote: ... pLenti CMV Puro DEST (w118-1) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid# 17452; RRID: Addgene_17452). The open reading frame for MCL1 was obtained as a gift from Dr ...
-
bioRxiv - Cancer Biology 2020Quote: ... and pLenti CMVTRE3G eGFP Neo (w821-1) were gifts from Eric Campeau (Addgene plasmids #26429 and #27569; RRIDs: Addgene_26429 and Addgene_27569). BCL2L1 (Bcl-xL ...
-
bioRxiv - Microbiology 2021Quote: ... 8 × 105 293 T cells in a 6 cm dish were cotransfected with 2 μg of HIV-1 packaging plasmid pCMVΔ8.2 R (Addgene # 12263); 0.5 μg of the pCMV-VSV-G plasmid (Addgene # 8454 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The two configurations that enabled efficient packaging of full-length vector genomes (designs 1 and 4) are available on Addgene (pEJS1099: Dual-sgRNA:Design 4, Addgene #159537 ...
-
bioRxiv - Cell Biology 2021Quote: ... EGFP and 1 kb homology arms flanking the insertion site were cloned into pHD-DsRed-attP (Addgene plasmid #51019) using Infusion technology (Takara/Clontech) ...
-
bioRxiv - Cell Biology 2021Quote: ... pAAV-mDlx-GFP-Fishell-1 was kindly provided by Gordon Fishell (Addgene plasmid #83900; http://n2t.net/addgene:83900; RRID: Addgene_83900). The AAV plasmid vector including the mouse alpha-CaMKII promoter was kindly provided by Akihiro Yamanaka (Nagoya University) ...
-
bioRxiv - Molecular Biology 2022Quote: ... and Caprin-1 were expressed using a pET-derived expression vector (Addgene, pET His6 MBP Asn10 TEV LIC, 1C) in E.coli Rosetta as N-terminal fusions to an N-terminally His6-tagged E.coli maltose-binding protein (MBP) ...
-
bioRxiv - Biochemistry 2021Quote: ... targets were identified for testing in exon 1 Ensembl.org exon id=ENSMUSE00000375205 with the algorithm described by Hsu and colleagues52 and cloned into plasmid pX330 (Addgene.org plasmid #42230 ...
-
bioRxiv - Immunology 2020Quote: ... The sgRNA sequence against HPT (Table 1) was cloned into the pSS013-Cas9 vector (pU6 plasmid, Addgene plasmid # 52694) using the BsaI specific sites ...
-
bioRxiv - Neuroscience 2020Quote: ... we infected adult Brn3cCre mouse retinas with 1 ml Cre dependent AAV Virus (AAV2-CAG-FLEX-EGFP-WPRE, Addgene catalog # ...
-
bioRxiv - Cancer Biology 2021Quote: ... These pLKO.1 constructions were transfected in the 293T packaging cell line along with pMD2.G and pCMV-dR8.91 vectors (Addgene), following a typical Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Immunology 2021Quote: ... and a separate master mix was prepared comprising 1 mL Opti-MEM 8 µg PSPAX (12260, Addgene, Watertown, MA), 2 µg PMD2G plasmids (12259 ...
-
bioRxiv - Biochemistry 2020Quote: ... To generate mec-4p∷hrp-1 mScarlet plasmids, mScarlet (Bindels et al., 2017) was amplified from pmScarlet_C1 (Addgene 85042) and assembled into hrp-1HsLCWT using NEBuilder HiFi DNA Assembly kit and introducing the D290V mutation by Quickchange ...
-
bioRxiv - Cell Biology 2022Quote: ... then ligated into the pENTR1A no ccDB (w48-1) vector (a gift from Eric Campeau and Paul Kaufman, Addgene plasmid # 17398 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and SV40-T/t antigens expressing lentiviruses using vectors pLenti CMV-RasV12-Neo (w108-1) (HRAS G12V, #22259, Addgene), and pLenti-CMV/TO-SV40 small + Large T (w612-1 ...
-
bioRxiv - Cell Biology 2019Quote: ... pcDNA3.1 TEV (full-length) was a gift from Xiaokun Shu (Addgene plasmid #64276; http://n2t.net/addgene:64276; RRID: Addgene_64276)(To et al. ...
-
bioRxiv - Biochemistry 2020Quote: ... Precission protease was produced as a GST fusion in Escherichia coli BL21 (DE3) from pGEX-6P-1 vector (Addgene). The cleaved Fc-fusion protein were passed through a protein-A column ...
-
bioRxiv - Molecular Biology 2021Quote: The cell cycle reporter vector pCSII-EF-miRFP709-hCdt(1/100) was a kind gift from Vladislav Verkhusha (Addgene plasmid # 80007 ...
-
bioRxiv - Pathology 2020Quote: ... all inserts were sub-cloned to an expression vector containing hygromycin resistance (pLenti CMV Hygro DEST 117-1, Addgene) using the Gateway recombination system ...
-
bioRxiv - Microbiology 2020Quote: The lentiviral vector was prepared by recovering the culture supernatant of 293T cells transfected with CSII-CMV-FNF-DsRed together with expression plasmids for HIV-1 Gag-Pol and Rev (pCMVR8.74, Addgene plasmid #22036 ...
-
bioRxiv - Microbiology 2020Quote: ... pcDNA3 HA eIF4GI (1–1599) was a gift from Nahum Sonenberg (Addgene plasmid #45640; http://n2t.net/addgene:45640; RRID Addgene_45640). The efficiency of expression was verified by western blotting.
-
bioRxiv - Microbiology 2020Quote: ... pShuttle-hACE2 was linearized with PmeI and subsequently cotransformed with the HuAdv5 backbone plasmid (pAdEasy-1 vector; Addgene 240005) into E ...
-
bioRxiv - Cell Biology 2021Quote: ... NatMX6 gene-replacement was performed by amplifying the NatMX6 cassette from the p41Nat 1-F GW plasmid (Addgene #58546) using 45 bp primers flanking the APS3 ORF ...
-
bioRxiv - Immunology 2021Quote: ... HIV-1 dual reporter vector expressing mCherry and luciferase (NL4-3 mCherry Luciferase, plasmid#44965) was purchased from Addgene. Plasmid expression a C-terminally truncated SARS-CoV-2 S protein (pSARS-CoV-2Δ19 ...
-
bioRxiv - Cell Biology 2020Quote: ... and mCCND1-CDK4-mVenus was inserted into the FRT site of RPE-1 FRT/TO mRuby-PCNA expressing in addition ectopic pCAGGs-NLS-TIR1_P2A_NES-TIR1 (Addgene: 117699). pCAGS-myc-BirA-P2A-3xflag-Avitag-UFM1-IRESpuro3 was electroporated into RPE-1 H3.1-mTurquoise2 + mRuby-PCNA UFM1 knockout cells followed by selection for stable integrands expressing 3xflag-Avitag-UFM1 to the same level as endogenous UFM1 (see Figure S4D ...
-
bioRxiv - Cancer Biology 2021Quote: ... Lentiviral expression constructs were obtained by cloning CDA and CDAE67Q ORF into pCMV blasticidin DEST 706-1 vectors (Addgene) using the Gateway strategy (Invitrogen) ...
-
bioRxiv - Immunology 2020Quote: ... The recombinant DNA encoding TCRMART-1 was synthesized by GeneScript (Nanjing, China) and ligated into pRRLSIN.cPPT.PGK vector (Addgene, 12252).
-
bioRxiv - Molecular Biology 2021Quote: ... was modified to contain the H840A mutation from pCMV-PE2 [1] (a gift from David Liu, Addgene plasmid # 132775) by EcoRV and PmlI fragment sub-cloning ...
-
bioRxiv - Developmental Biology 2021Quote: ... Two guides were designed using the http://crispr.mit.edu tool (guide 1: CGGCTACTCCACTGTGGCGG; guide 2: CGCTTCTTGGGCCGGATGAG) and were cloned into the pX458 plasmid (Addgene, #48138) as previously described (55) ...