Labshake search
Citations for Addgene :
1501 - 1550 of 2145 citations for Osteopontin Human OPN ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2019Quote: ... Lentiviral vector pBABE-puro-SDF-1 alpha was a gift from Bob Weinberg (Addgene plasmid #12270) 75 ...
-
bioRxiv - Neuroscience 2020Quote: ... the target sequence (5’-GGGTGAAGATCCTGTTCAATA-3’) was shuttled to the pLKO.1-Hygromycin vector (Addgene, #24150). For human astrocytes ...
-
bioRxiv - Bioengineering 2019Quote: ... of a custom GFPACG gBlock cassette (Supplementary Table 1) into AcsI/AgeI-digested SGEN (Addgene #111171) backbone ...
-
bioRxiv - Neuroscience 2021Quote: ... and pAAV5-CaMKII-hChR2(H134R)-eYFP-WPRE (titer ≥ 1×1013 vg/mL, Addgene, Catalog # 26969-AAV5).
-
bioRxiv - Cell Biology 2021Quote: ... pclbw-opa1(isoform 1)-myc (myc-Opa1) was a gift from David Chan (Addgene plasmid # 62845) 47 ...
-
bioRxiv - Cell Biology 2020Quote: ... HEK293T cells were transfected with the pLenti-PGK-Tacc3 or pLKO.1 TRC (control, Addgene 10879), pMD2G (Addgene 12259 ...
-
bioRxiv - Neuroscience 2022Quote: ... 2 µL of the adeno-associated viral vector rAAV9/1.EF1a.DIO.hChR2(H134R)-eYFP.WPRE.hGH (Addgene, #20298-AAV9) was dyed with 0.3 µL fast green (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2022Quote: ... Virus (0.25-1 μl) containing either AAV5: hSyn-DIO-hM3Dq-mCherry (excitatory DREADD; Addgene, Watertown MA), AAV5 ...
-
bioRxiv - Immunology 2022Quote: ... and Bach2 ORF (Origene, MR224703 cloned into Addgene, Cat# 52107, 1 μg/ml, marked by GFP) using the X-tremeGENE transfection reagent (Sigma Aldrich ...
-
bioRxiv - Molecular Biology 2020Quote: ... lentivirus destination vector or into the pLenti CMV Puro DEST (w118-1) vector (Addgene Plasmid #17452) using Gateway LR Clonase (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2021Quote: ... RRL.sin.cPPT.SFFV/TMPRSS2(variant 1).IRES-neo.WPRE (MT130) was a gift from Caroline Goujon (Addgene plasmid # 145843). pGBW-m4137383 was a gift from Ginkgo Bioworks (Addgene plasmid #149541) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Annealed gRNA oligos were ligated to pLKO.1-puro U6 sgRNA BfuAI stuffer (Addgene plasmid # 50920) or to pLenti SpBsmBI sgRNA Hygro (Addgene plasmid # 62205) ...
-
bioRxiv - Genomics 2022Quote: ... 1-10 µg YAC/BAC payload DNA and 2-5 µg pCAG-iCre plasmid (Addgene #89573) per transfection ...
-
bioRxiv - Molecular Biology 2020Quote: 1×106 cells of WTC p42 were transfected with 5mg AAVS1-TALEN R plasmid (Addgene #59026), 5 μg AAVS1-TALEN L plasmid (Addgene #59025) ...
-
bioRxiv - Genetics 2020Quote: ... digested pENTR-LUC (w158-1; a kind gift from Eric Campeau & Paul Kaufman; Addgene plasmid #17473)(33 ...
-
bioRxiv - Neuroscience 2021Quote: ... and AAV.Syn.NES-jRGECO1a.WPRE.SV40 (Serotype 2/9; titer ≥ 1×1013 vg/mL) viruses were purchased from Addgene.
-
bioRxiv - Molecular Biology 2020Quote: ... The pLenti CMV rtTA3 Blast (w756-1) was a gift from Eric Campeau (Addgene plasmid #26429).
-
bioRxiv - Cancer Biology 2020Quote: ... was cloned into pINDUCER20 (Meerbrey et al., 2011) and pLenti CMV Blast DEST (706-1) (Addgene plasmid #17451 was a gift from Eric Campeau & Paul Kaufman ...
-
bioRxiv - Neuroscience 2019Quote: ... an AAV1:CBA:FLEX:Arch-GFP vector was used (UPenn [Addgene], cat. no. AV-1-PV2432 [22222-AAV1]). In mice for the control groups (Figs ...
-
bioRxiv - Biochemistry 2021Quote: ... and ASW (Uniprot Q9BVC5-1) were subcloned into the UC Berkeley MacroLab 438B (Addgene plasmid #55219), 438Rgfp (Addgene plasmid #55221) ...
-
bioRxiv - Biochemistry 2021Quote: ... and ASW (Uniprot Q9BVC5-1) were subcloned into the UC Berkeley MacroLab 438A (Addgene plasmid #55218) plasmid along with sequences encoding N-terminal affinity/fluorescence tags ...
-
bioRxiv - Microbiology 2020Quote: ... pLenti CMV Blast DEST (706-1) (a gift from Eric Campeau & Paul Kaufman (Addgene plasmid #17451)) constructs carrying a human Plxdc1-TwinStrep or Plxdc2-TwinStrep expression cassette (pLenti-CMV-Blast-Plxdc1-Strep/ pLenti-CMV-Blast-Plxdc2-Strep ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2012) were cloned into the pLKO.1-Puro vector (a gift from R. Weinberg; Addgene #8453) to generate pLKO.1-Cys-TD and pLKO.1-Scr-TD ...
-
bioRxiv - Immunology 2021Quote: ... Guide 1 (TGTTGGGGAACATATGACAC) and Guide 2 (AAGGAAAAATTCAAACAAGG) sequences were cloned into lentiGuide-puro plasmid (Addgene, #52963), transformed in Stbl3 bacteria (Invitrogen ...
-
bioRxiv - Immunology 2020Quote: ... Major changes to the reported protocol included: 1) Use of a 2nd generation psPAX2 (Addgene, #12260) lentivirus packaging system instead of the 3rd generation system used by the Bloom lab ...
-
bioRxiv - Neuroscience 2022Quote: ... mice were infused with diluted (1:5) or undiluted virus pAAV5-CAMKIIa-(hChR2- H134R)-eYFP (Addgene-ChR2 titre ...
-
bioRxiv - Cell Biology 2022Quote: ... The GFP-RIAM(1-666) construct was a gift from Chinten James Lim (Addgene plasmid 80028) (Lee et al. ...
-
bioRxiv - Genetics 2022Quote: ... Transfection mix for each shRNA contained 8.75μg of shRNA targeting construct in pLKO.1 (Addgene#8453), 8.75μg psPAX2 (Addgene#12260 ...
-
bioRxiv - Physiology 2023Quote: ... pAAV-CAG-Flex.GCaMP6f.WPRE (3.15×1013 vg/ml, working dilution 1:10, Addgene plasmid #100835-AAV5; http://www.addgene.org/100835/; RRID:Addgene_100835) was a gift of Douglas Kim and GENIE Project ...
-
bioRxiv - Neuroscience 2022Quote: ... adeno-associated virus AAV8 carrying CaMKII-GCaMP6f (pENN.AAV.CamKII.GCaMP6f.WPRE.SV40. Addgene. #100834. 1×1012 genome copies per ml) was injected with Nanoject-III (Drummond Scientific Company ...
-
bioRxiv - Molecular Biology 2022Quote: ... was used per manufacturer’s instruction to add 1 µg of the mRFP-UtrCH plasmid (Addgene #26739) to both WT and PDKO T-REx-293 cells seeded in 6-well plates at ∼70% confluency ...
-
bioRxiv - Cancer Biology 2022Quote: ... Annealed gRNA oligos were ligated to pLKO.1-puro U6 sgRNA BfuAI stuffer (Addgene plasmid #50920), and lentiviral particles were generated ...
-
bioRxiv - Molecular Biology 2023Quote: ... as well as overhangs for assembly into the STARR-seq vector (Addgene #99296; Supplemental Table 1) according to the manufacturer’s instruction (10 to 11 cycles of amplification) ...
-
bioRxiv - Neuroscience 2022Quote: ... Mice were injected with ∼2000 nl of a 1:6 ratio of AAV1-Syn-Cre (AAV.hSyn.Cre.WPRE.hGH, 105553-AAV1, Addgene) and AAV1-CAG-tdTomato (59462-AAV1 ...
-
bioRxiv - Neuroscience 2023Quote: PV-IRES-Cre mice were injected with AAV2/8.CAG.Flex.eGFP (Addgene, titer ≥ 1×10¹³ vg/mL) anterograde tracing virus in the HDB (antero-posterior ...
-
bioRxiv - Neuroscience 2023Quote: ... 600 nL (in AuCx) or 1 µL (in IC) of AAV1-hSyn-hChR2(H134R)-EYFP (Addgene, Item# 26973-AAV1 ...
-
bioRxiv - Neuroscience 2023Quote: ... For anterograde transsynaptic tracing: AAV1-hSyn-Cre-WPRE-hGH (1013 gc/ml, Addgene; 1:10 dilution) was injected in DCN (coordinates as above) ...
-
bioRxiv - Genetics 2023Quote: ... and the annealed sense and antisense shRNA oligonucleotides were cloned into pLKO.1-puro vector (Addgene) for knockdown of human KISS1 ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV1-hSyn-GCaMP7b (2 × 1013 vg/mL Penn Vector Core/Addgene; diluted 1:2 in saline) for imaging of pulvinar axons ...
-
bioRxiv - Developmental Biology 2023Quote: H2B-EGFP mRNA was transcribed from plasmid #1 pCS-H2B-EGFP (Megason, 2009) (Addgene, Plasmid #53744). To construct pCS2-myrTagRFP-T (plasmid #2) ...
-
bioRxiv - Genetics 2023Quote: pHarvester was generated using pCFD5-gRNA#1&2 and pnos-Cas9-nos plasmids (Addgene no: 62208). Briefly ...
-
bioRxiv - Cell Biology 2023Quote: ... Both pie-1p and pie-1 3’UTR PCR products were amplified using pPK605 plasmid (Addgene) as the template.
-
bioRxiv - Cancer Biology 2023Quote: SNAIL and SLUG knockout PANC-1 cell lines were generated using lentiCas9-Blast (Addgene plasmid 52962) and lentiGuide-Puro (Addgene plasmid 52963 ...
-
bioRxiv - Neuroscience 2023Quote: ... Addgene #55639 (packaged in AAV2/1) AAV2/8-EF1a-fDIO-ChrimsonR-mRuby2-KV2.1TS modified from Addgene #124603 pAAV-hSyn1-SIO-stGtACR2-FusionRed ...
-
bioRxiv - Developmental Biology 2023Quote: Lentiviral shRNA expression constructs were generated by first modifying the pLKO.1 puro vector (Addgene #8453), digesting with BamHI and KpnI and replacing the puromycin resistance cassette with an mCherry coding sequence.
-
bioRxiv - Biochemistry 2023Quote: ... Mouse H2A.Z.1 gene in pIND-EGFP was a kind gift from from Danny Rangasamy (Addgene plasmid # 15770 ...
-
bioRxiv - Neuroscience 2023Quote: Heterozygous ChAT-Cre mice were bilaterally injected with 1.0 µL of pAAV.Syn.Flex.GCaMP6s.WPRE.SV40 (diluted 1:2 in dPBS; Addgene: 100845-AAV5) in basal forebrain (AP ...
-
bioRxiv - Cell Biology 2024Quote: ... F-tractin and Linker 1 were derived from pEGFP-C1 F-tractin-EGFP (Addgene Plasmid #5847)48 ...
-
bioRxiv - Cancer Biology 2023Quote: ... pLKO.1 and pLKO.5 were sourced from Addgene (#1864; a gift from David Sabatini 9) and Sigma-Aldrich (St ...
-
bioRxiv - Neuroscience 2024Quote: ... The he1.1:YFP cassette (he1.1:YFP_F, he1.1:YFP_R, Table 4) was amplified from p3E_he1a:YFP (Addgene, plasmid #113879), and the polyA terminator (polyA_F ...