Labshake search
Citations for Addgene :
1501 - 1550 of 2471 citations for DCN1 like protein 1 DCUN1D1 Human His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: shRNAs and were cloned into pLko.1-puro (Addgene #8453) linearized with AgeI and EcoRI ...
-
bioRxiv - Cancer Biology 2024Quote: ... or an empty backbone pLKO.1 control (Addgene plasmid #8453) were used to generate virus and infect OVCAR3 cells or ID8 cells ...
-
bioRxiv - Cell Biology 2022Quote: ... GGAACAAGTTCAGTGAACTG, #3: TGCATGCTCACTGATAATGA), IFIH1 (#1: CTTGGACATAACAGCAACAT, #2: TGAGTTCCAAAATCTGACAT) or TLR3 (#1: ACGACTGATGCTCCGAAGGG, #2: ACTTACCTTCTGCTTGACAA, #3: GGAAATAAATGGGACCACCA) and control gRNAs (Addgene plasmid #51763, #51762 and #51760) were ligated into pLentiCRISPRv2 (Addgene plasmid # 52961 ...
-
bioRxiv - Neuroscience 2022Quote: ... rAAV2-retro-CMV-bGlo-iCre-GFP (made in house; 1.07×1012 GC ml-1; 17) and AAV2-hSyn-DIO-hM4D(Gi)-mCherry (Addgene #44362; 4.6×1012 GC ml-1; 19); chemogenetic non-projection specific inhibition experiments AAV8-hSyn-hM4D(Gi)-mCherry (Addgene #50475 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The following ORF24 fragments: residues 1-201 (ORF24-NTD) (Addgene #138420), residues 1-271 (Addgene #138421) ...
-
bioRxiv - Developmental Biology 2020Quote: ... A control PLKO.1 vector containing a scrambled shRNA (Addgene 1864) was used as a control ...
-
bioRxiv - Cell Biology 2019Quote: ... PX458 or PX458 containing gRNA and PLKO.1-puro (Addgene, #10878), were co-transfected into MEFs ...
-
bioRxiv - Biochemistry 2019Quote: The pLKO.1-puro empty vector was purchased from Addgene (#8453). A scrambled shRNA control and gene-specific shRNAs were designed through RNAi Central (http://cancan.cshl.edu/RNAi_central/step2.cgi) ...
-
bioRxiv - Neuroscience 2020Quote: ... AAVrg-Ef1α-mCherry-IRES-Cre (Titer ≥ 7×1012 vg.mL−1, Addgene). Cholera Toxin Subunit B (Recombinant) ...
-
bioRxiv - Neuroscience 2020Quote: rAAV5-hSyn-hChR2(H134R)-eYFP (Titer ≥ 7×1012 vg.mL−1, Addgene), rAAV5-hSyn-Jaws-KGC-GFP-ER2 (Titer ≥ 3.8×1012 vg.mL−1 ...
-
bioRxiv - Neuroscience 2020Quote: ... rAAV5-hSyn-hChR2(H134R)-mCherry (Titer ≥ 7×1012 vg.mL−1, Addgene), rAAV5-Ef1α-DIO-hChR2(H134R)-eYFP (Titer ≥ 4.2×1012 vg.mL−1 ...
-
bioRxiv - Neuroscience 2020Quote: ... A pLKO.1-TRC vector (a gift from David Root; Addgene plasmid #10879 ...
-
bioRxiv - Microbiology 2021Quote: ... Expression vectors for SARS-CoV-2 Wuhan-Hu-1 (Addgene, #149539), SARS-CoV-2 B.1.167.2 (Addgene ...
-
KIF24 controls the clustering of supernumerary centrosomes in pancreatic ductal adenocarcinoma cellsbioRxiv - Cell Biology 2022Quote: ... or negative control annealed oligo was inserted into pLKO.1 (Addgene) (Stewart et al ...
-
bioRxiv - Neuroscience 2020Quote: ... pLKO.1-TSC2 was a gift from Do-Hyung Kim (Addgene plasmid # 15478 ...
-
bioRxiv - Neuroscience 2020Quote: ... and ligated into the pLKO.1 vector (Addgene, 8453 or 26655). Overexpression vectors of either lentiviral (N106 or N174 ...
-
bioRxiv - Systems Biology 2022Quote: pSIRV-AP-1-mCherry was a gift from Peter Steinberger (Addgene plasmid # 118095 ...
-
bioRxiv - Neuroscience 2022Quote: ... a 3:1 mixture of AAV-CAG-Flex-oG (Addgene #74292) and ΔG-Rab-GFP was injected into either the GS or TA muscles of P1-P2 pups ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... pCMV-p38-CA-EGFP and pCMV-eGFP-N1 (Addgene, 6085-1) by using standard Lipofectamine 3000 protocols (ThermoFisher ...
-
bioRxiv - Cell Biology 2019Quote: ... from Thermo Fisher at a 1:1.5 Lipo:DNA ratio for GFP-Cortactin (Addgene 50728), mEmerald-Talin (Addgene 54266 ...
-
bioRxiv - Cell Biology 2020Quote: Individual sgRNAs (Supplemental Table 1) were cloned into pLentiCRISPRv2 (Addgene #52961) at the BsmBI site as described by the depositor ...
-
bioRxiv - Cell Biology 2020Quote: ... Mouse Mannosidase II amino acids 1-116 was amplified from Addgene plasmid #65261 using a forward primer that contains an XbaI site and a reverse primer with an MluI site and further subcloned upstream of the mCherry open reading frame.
-
bioRxiv - Cancer Biology 2021Quote: ... gRNA-1 and -2 were cloned into pL-CRISPR.EFS.GFP (Addgene, #57818) and pL-CRISPR.EFS.tRFP (Addgene plasmid #57819) ...
-
bioRxiv - Neuroscience 2021Quote: were generated using pLKO.1 vector following instructions provided by Addgene. The shRNA sequence was selected using BLOCK-iT™ RNAi Designer provided by Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2020Quote: ... SH2 domain sequences were obtained from Addgene (pGEX-SHP-1(NC)-SH2 ...
-
bioRxiv - Genomics 2022Quote: ... 1 mL of overnight culture containing pTXB1-Tn5 (Addgene plasmid #60240) was used to inoculate 1 L of ZYM-505 growth media containing 100 μg/mL ampicillin and 0.001% polypropylene glycol (L14699-AE ...
-
bioRxiv - Biochemistry 2022Quote: DNA constructs for the expression of KRAS4B (1-169) (Addgene #159539) and RAF1 (52-131 ...
-
bioRxiv - Neuroscience 2022Quote: ... for glutamate imaging or 1 μl pENN.AAV.CamKII.GCaMP6f.WPRE (Addgene, plasmid #100834-AAV1) for calcium imaging were administered directly into the hippocampus ...
-
bioRxiv - Microbiology 2022Quote: ... HIV-1 GagPol was expressed by pCMV ΔR8.2 (Addgene plasmid # 12263). The protease mutations D25N and R57G were generated by overlapping PCR using pCMV ΔR8.2 as a template ...
-
bioRxiv - Physiology 2023Quote: ... working dilution 1:5) or d-Light1 (pAAV-CAG-dLight1.1, Addgene viral prep # 111067-AAV5 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and the OMS using TOMM20 (residues 1-55, from Addgene 66753).
-
bioRxiv - Cancer Biology 2023Quote: ... plasmids as described previously.11 pLKO.1-Scrambled plasmids (Addgene, #136035) were used as negative control ...
-
bioRxiv - Physiology 2023Quote: ... pLKO.1-Puro-scramble shRNA (1864) plasmids were obtained from Addgene. The NAA10-Myc plasmid was constructed by subcloning of a Myc-His tag to replace the Myc-DDK tag in the hNAA10-Myc-DDK plasmid (RC201354 ...
-
bioRxiv - Cell Biology 2023Quote: SH-SY5Y cells stably overexpressing LAMP-1-Flag-RFP (Addgene; #102931) and stained with CellMask Green (1/1000 ...
-
bioRxiv - Molecular Biology 2023Quote: ... The Level 1 plasmids pL1P1OsActinP:hpt-int:35sT selection cassette (Addgene #165423), pL1P2OsUbiP:Cas9:NosT (Addgene #165424) ...
-
bioRxiv - Biophysics 2023Quote: ... the pLKO.1 puro (Addgene; 8453; a gift from Bob Weinberg) backbone was used ...
-
bioRxiv - Neuroscience 2022Quote: ... and AAV2retro-syn-jGCaMP7f-WPRE (Addgene 104488, 1 × 1013 GC/ml) [1:1 mixture] ...
-
Zero-shot learning enables instant denoising and super-resolution in optical fluorescence microscopybioRxiv - Bioengineering 2023Quote: ... and the sgRNA was ligated into pX330A-1×2 (Addgene, 58766). To construct donor vector ...
-
bioRxiv - Neuroscience 2022Quote: ... and 100-200 nl cre-dependent tdTomato (AAV2/1.FLEX.tdTomato.WPRE.SV40, Addgene), and some cases ...
-
bioRxiv - Cell Biology 2023Quote: ... Wild type Keratin 8 was cloned into pGEX-6p-1 (Addgene) (WT-K8-GST ...
-
bioRxiv - Cell Biology 2023Quote: ... The Level 1 plasmids pL1P1OsActinP:hpt-int:35sT selection cassette (Addgene #165423), pL1P2OsUbiP:Cas9:NosT (Addgene #165424 ...
-
bioRxiv - Neuroscience 2023Quote: ... These genomes were packaged in serotype 1 AAV capsids by Addgene (catalog numbers 52473-AAV1 ...
-
bioRxiv - Genomics 2022Quote: ... and pSLQ1852-2 pHR: U6-SpsgCD95-1 CMV-EGFP (Addgene 84151) with slight modifications ...
-
bioRxiv - Cancer Biology 2023Quote: ... shCtrl-1 (negative control vector containing a nonhairpin insert Addgene #1864) and shCtrl-2 (MISSION® pLKO.1-puro non-mammalian shRNA Control Plasmid DNA ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... ElonginC (17–112) and ElonginB (1–104) (Addgene ID 204500 & 204501) were co-expressed in E ...
-
bioRxiv - Neuroscience 2023Quote: ... or AAVrg.Syn.jGCaMP7b.WPRE (Addgene, lot. no. v63074, titer 1 x x 1013). For sparse expression of GCaMP in the brainstem neurons ...
-
bioRxiv - Neuroscience 2024Quote: AAV serotype 1 CaMK2a-EYFP (1.0 × 1013 gp/mL) (Addgene #105622)
-
bioRxiv - Immunology 2023Quote: ... pcDNA3.3_SARS2_omicron BA.1 (Addgene plasmid #180375; http://n2t.net/addgene: 180375; RRID:Addgene_180375) and pcDNA3.3_SARS2_omicron BA.2 (Addgene plasmid #183700 ...
-
bioRxiv - Neuroscience 2023Quote: ... and one of the following helper plasmids: pAAV2/1 (Addgene #112862), pAAV2/2 (Addgene #104963) ...
-
bioRxiv - Biophysics 2023Quote: ... a pCDFDuet-1 plasmid containing His6-PPX-nsp7/8 (Addgene: 159092) was transformed into E ...