Labshake search
Citations for Addgene :
1301 - 1350 of 2471 citations for DCN1 like protein 1 DCUN1D1 Human His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... 1/10th mass BirA (Addgene plasmid 20857), and 50 µM D-biotin at 30 °C for 1 h ...
-
bioRxiv - Cancer Biology 2023Quote: ... and empty pKLO.1-hygro (Addgene, 24150) were used as negative controls.
-
bioRxiv - Cancer Biology 2023Quote: ... pMD2.G (1 µg; Addgene, Cat# 12259) and psPAX2 (2 µg ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 1 μg packaging plasmid (Addgene #12260). 24 hours post transfection ...
-
bioRxiv - Cancer Biology 2023Quote: ... pLKO.1-shGFP control (Addgene, cat#30323); pLKO.1-shATR (TCRN0000039615 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and inserted into pLKO.1 Vector (Addgene). To package the third generation lentiviral vectors ...
-
bioRxiv - Microbiology 2023Quote: ... and pMD2.G (1 µg, Addgene, 12259), plus the pscALPS-hACE2 or -cACE2 (1 µg ...
-
bioRxiv - Immunology 2023Quote: ... pLenti CMV rtTA3 Blast (Addgene w756-1) stably expressing clonal RAW MΦs were transduced with pLenti CMV Puro DEST (Addgene w118-1 ...
-
bioRxiv - Immunology 2024Quote: ... psPAX2 (1 µg; Addgene plasmid no. 12260) and pTRIP-SFFV-CD271-P2A-ACE2 (1.6 µg ...
-
bioRxiv - Cell Biology 2023Quote: ... and cloned into pLKO.1 (Addgene #10878). The VSV-G envelope expressing plasmid pMD2.G ...
-
bioRxiv - Cell Biology 2024Quote: ... and 1 μg psPAX2 (Addgene plasmid #12260) in 50 μL Opt-MEM (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2024Quote: ... DR8.2 (1 µg) packaging construct (Addgene #8455) and the PMD2.G (5 μg ...
-
bioRxiv - Cell Biology 2019Quote: Fluorescent protein sequences were obtained from lab stocks with the exception of mTagBFP2 which was amplified from mTagBFP2-pBAD (Addgene, Watertown, USA; plasmid ID 54572). The 3mTagBFP2 was a kind gift from Serge Pelet (University of Lausanne ...
-
bioRxiv - Cell Biology 2020Quote: ... Stable expression of fluorescently tagged ciliary and centriolar proteins was achieved by modification of pCW-Cas9 using cDNAs encoding ARL13B (Addgene #40879, gift from Tamara Caspary), EHD1 (gift from Chris Westlake) ...
-
bioRxiv - Neuroscience 2023Quote: ... the cells were transiently transfected with green fluorescent protein (eGFP) (0.25 µg of cDNA/ml) and PIEZO1 channel plasmid (Addgene, #80925, 3 µg of cDNA/ml). For control experiments ...
-
bioRxiv - Neuroscience 2019Quote: ... Site-directed integration into attP sites was achieved by co-injection of an attB-containing vector (400 ng µl−1) and either p3xP3-EGFP.vas-int.NLS (400 ng µl−1) (Addgene #60948)69 or pBS130 (encoding phiC31 integrase under control of a heat shock promoter ...
-
bioRxiv - Cancer Biology 2020Quote: ... pLenti CMV rtTA3 Blast (w756-1) and pLenti CMVTRE3G eGFP Neo (w821-1) were gifts from Eric Campeau (Addgene plasmids #26429 and #27569 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The two configurations that enabled efficient packaging of full-length vector genomes (designs 1 and 4) are available on Addgene (pEJS1099: Dual-sgRNA:Design 4, Addgene #159537; pEJS1096: Dual-sgRNA:Design 1, Addgene # 159538). Oligonucleotides with spacer sequences for target genes were inserted into the sgRNA cassette by ligation into the BspQI and BsmBI cloning sites.
-
bioRxiv - Cell Biology 2021Quote: ... Cells settled to the bottom of the well for 5 minutes at room temperature and then 0.25 μL of F-OKMS lentiviral mix (1:1 of Addgene plasmids 51543 ...
-
bioRxiv - Cell Biology 2022Quote: ... The lentiviral particles of shZDHHC5 (target sequence 5’CCCAGTTACTAACTACGGAAA3’ in pLKO.1 vector) and empty pLKO.1 (Addgene, 8453) were packaged in HEK293T cells and used to transduce PCDH7-GFP-BAC cells ...
-
bioRxiv - Molecular Biology 2020Quote: ... NSUN6 knockdown mediated by shRNA was performed using pLKO.1-blast plasmid (modified from pLKO.1-puro, #10878, Addgene) with following shRNAs ...
-
bioRxiv - Neuroscience 2022Quote: ... 0.8 uL of a 1:1 mixture of EGFP (AAV9- Hsyn-DIO-EGFP;4.6*10^13 GC/mL; Addgene) and AAV8-GAD1-cre was injected unilaterally into VP ...
-
bioRxiv - Microbiology 2023Quote: ... pLentiCMVPuroDEST (w118-1) and pLentiCMVHygroDEST (w117-1) were gifts from Eric Campeau & Paul Kaufman (Addgene plasmids #17452 and #17454) [33] ...
-
bioRxiv - Genomics 2022Quote: ... Each 15-cm2 plate was transfected with a total of 21 μg of plasmid DNA (1:2:1 ratio psPAX2-D64V:pLenti-STARR:pLAI-Env) [psPAX-D64V (Addgene #63586), and pLAI-HIV (Addgene #133996)] ...
-
bioRxiv - Neuroscience 2023Quote: ... or a 1:1 combination of GCaMP6f+hM4Di-mCherry (same as used for behavior, AAV8-CaMKIIa-hM4Di-mCherry, Addgene).
-
bioRxiv - Genomics 2024Quote: ... the 1 μg of total DNA was split in a 1:15 ratio of pCAG-NLS-Bxb1 (Addgene #51271) and recombination vector ...
-
bioRxiv - Developmental Biology 2023Quote: ... animals were injected with a target transgene (50 ng μl-1) with plasmid pJL43.1 (50 ng μl-1) (Addgene) that expresses MosTase under a germline promoter and plasmid pMR910 (20 ng μl-1 ...
-
bioRxiv - Cancer Biology 2024Quote: Viral particles were packaged in HEK293T cells by transfecting the pLKO.1-shCYB561 constructs or scrambled shRNA pLKO.1 (RRID:Addgene_1864) (30 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... were generated using three plasmids to ensure a single round of infectivity: a pseudotyping plasmid for transient expression of the VSV-G envelope protein (pMD2.G, Addgene plasmid #12259, gift from Didier Trono), a plasmid for transient expression of the viral gag/pol ...
-
bioRxiv - Molecular Biology 2023Quote: The MCS of pBAD24 (Guzman et al., 1995) was exchanged for the red fluorescent protein (RFP) cassette from pPGC-C (Addgene plasmid # 174580,(Bentham et al., 2021)) flanked by BsaI restriction sites ...
-
bioRxiv - Microbiology 2022Quote: ... All shRNAs were generated by cloning shRNA hairpin sequences found in Table 3 into pLKO.1-TRC Puro (pLKO.1-TRC cloning vector was a gift from David Root (Addgene plasmid # 10878 ...
-
bioRxiv - Cell Biology 2022Quote: ... Dynamin 2-mTFP1 (or dynamin 1-mTFP1) construct was created by replacing the EGFP tag of dynamin 2-EGFP (or dynamin 1-EGFP, Addgene) with mTFP1 (Addgene) ...
-
bioRxiv - Cell Biology 2021Quote: ... and pLenti CMV rtTA3 Hygro (w785-1) used for creating tetracycline-inducible cell lines were gifts from Eric Campeau (w762-1: Addgene plasmid #26434 ...
-
bioRxiv - Cancer Biology 2021Quote: ... For loss of function studies, pLKO.1 puro and pLKO.1 shCDH1 (Onder et al., 2008) were purchased from Addgene. pLL3.7m-Clover-Geminin(1-110)-IRES-mKO2-Cdt(30-120 ...
-
bioRxiv - Cell Biology 2022Quote: ... gBlock 1 encoding N-terminus Calponin domains (CH-CH) of giant Nesprin 1 was cloned into Spectrin-cpstFRET (plasmid#61109, Addgene) cut with AgeI and ScaI renstriction enzymes (New England Biosciences) ...
-
bioRxiv - Neuroscience 2020Quote: ... AAV1.hSyn.GCaMP6f.WPRE.SV40 (120 nl, 2×1013 vg/mL Penn Vector Core/Addgene; diluted 1:2 to 1:10 in saline) was injected either into V1 ...
-
bioRxiv - Cell Biology 2019Quote: ... The short isoform of human NEAT-1 lncRNA (hNEAT-1 v1) was amplified from the plasmid pCRII_TOPO_hNEAT1 (a gift from Archa Fox, Addgene plasmid 61518) and incorporated into an AgeI/BamHI digested pmax-ponA backbone vector ...
-
bioRxiv - Microbiology 2020Quote: ... pmTurquiose2-Golgi (Beta-1,4-galactosyltransferase 1 1-61 Aa) in red is to show the Golgi apparatus (Addgene cat 36205) (27) ...
-
bioRxiv - Physiology 2019Quote: ... annealed and cloned into pLKO.1 at EcoRI and AgeI restriction sites as per the pLKO.1 protocol from Addgene. The resultant plasmids were transformed in DH5α cells for amplification and isolated ...
-
bioRxiv - Bioengineering 2022Quote: ... Each shRNA was cloned into the host pLKO.1-puro vector. PLKO-shFOXA1#1 (Cat. #: 70095) and PLKO-shFOXA1#2 (Cat. #: 70096) were obtained from Addgene, and previously used 45 ...
-
bioRxiv - Cell Biology 2023Quote: PARP-1 sgRNAs (#1, GTGGCCCACCTTCCAGAAGC; #2, ATACCAAAGAAGGGAGT-AGC) were synthesized and subcloned into lenti-CRISPR vector (Addgene, pXPR_001, plasmid 49535). Lentiviral vectors were co-transfected into HEK293FT cells with the lentivirus packaging plasmids pVSVg and psPAX2 using FuGENE® HD ...
-
bioRxiv - Biophysics 2023Quote: ... The DNA fragment encoding the T-cell-restricted intracellular antigen-1 (TIA-1) was digested from pFRT-TO-eGFP-TIA1 (#106094, Addgene) using Bsp1407I (TaKaRa ...
-
bioRxiv - Neuroscience 2023Quote: ... we used a 1:1 combination of AAV8-CaMKIIα-GFP-Cre (UNC) and AAV2-hSyn-DIO-hM4D(Gi)-mCherry (Cat. #44362, Addgene).
-
bioRxiv - Neuroscience 2023Quote: ... slices were virally infected with 0.5-1 µl AAV mixture per slice (containing AAV9-Camk2a-Cre at 2 × 1012 vg/ml (1:1000 dilution, Addgene and rAAV8-DIO-CBA-pAAIP2-mEGP at 4.2 x 1012 vg/ml ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... with 0.5 µg of either a 1:1 mixture of the S plasmids and a Jun-Nt Venus fragment (Addgene 22012) plasmid or a mixture of hACE2 plasmid (kindly provided by Dr ...
-
bioRxiv - Developmental Biology 2023Quote: Transgenic animals were generated by injecting transgenes (15 ng μl-1 each) mixed with a co-injection marker pRF-4 (120 ng μl-1) (Addgene) expressing a dominant negative variant of the rol-6 gene and an empty vector pSK (up to 200 ng μl-1 of DNA ...
-
bioRxiv - Biochemistry 2024Quote: ... The Venus-PDZ1 (ZO-1) was generated by site directed mutagenesis of the Venus-ZO-1 expression vector (Addgene: 56394) using primer pairs that delete the entire ZO-1 coding sequence except for the first PDZ1 domain ...
-
bioRxiv - Neuroscience 2021Quote: ... The pLKO.1-TRC cloning vector (RRID: Addgene_10878) and the pLKO.1-sh-Ctl (RRID ...
-
bioRxiv - Neuroscience 2021Quote: ... and the pLKO.1-sh-Ctl (RRID: Addgene_10879) were kindly provided by Marian Martínez-Balbás ...
-
bioRxiv - Cell Biology 2021Quote: ... to either pLKO.1 puro (Addgene Plasmid #8453) for constitutive knockdown or Tet-pLKO-puro (Addgene Plasmid #21915 ...