Labshake search
Citations for Addgene :
1501 - 1550 of 2273 citations for 2 3 5 Dioxo 4 aza tricyclo 5.2.1.0*2 6* dec 8 en 4 yl propionic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... and 5 μg pCL-Eco (#12371, Addgene) in Opti-MEM with Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Genetics 2020Quote: ... 5 µg of psPax2 (Addgene, Cat# 12260), and 2 µg of pMD2.G (Addgene ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV2/5 (for AAV5; Addgene plasmid # 104964), or pAAV2/9n (for AAV9 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 µg envelope plasmid pMD2.G (Addgene), and 20 µg transfer plasmid (pTRIPZ ...
-
bioRxiv - Neuroscience 2024Quote: ... and pAAV2-5 were obtained from Addgene. pHelper plasmid was a gift from Matthew Banghart at the University of California ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 5 μg pMD2.G (Addgene, 12259) using PolyFect (Qiagen ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV2/5 (gifted from Melina Fan [Addgene plasmid # 104964 ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV1.hSyn.Flex.GCaMP6f.WPRE.SV40 (5 x 1012GC/mL, Addgene) was used to detect calcium (Ca2+ ...
-
bioRxiv - Biochemistry 2024Quote: ... and 5 µg pMD2.g (Addgene, 12259) combined with 1.8 mL Opti-MEM medium (Gibco ...
-
bioRxiv - Biochemistry 2024Quote: ... 5 µg of ATP1A1_plasmid_donor_RD (Addgene plasmid, #86551), and 2.5 µl ssODN donor (100 µM) ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 5 µg pMD2.G (Addgene #12259) were co-transfected into HEK 293T/17 cells (ATCC # CRL-11268 ...
-
bioRxiv - Neuroscience 2021Quote: ... C57BL/6 mice were injected with the AAV5-CAG-ChR2-mCherry adenovirus (200 nL, Addgene) in the PC ...
-
bioRxiv - Neuroscience 2021Quote: ... MEFs were then expanded to 6-well plates and transiently transfected with SV40T antigen (Addgene) and maintained until stably proliferative ...
-
bioRxiv - Neuroscience 2022Quote: [6] 15xQUAS from BAC-ECFP-15xQUAS_TATA-SV40 (a gift from Christopher Potter, Addgene ID #104875) (Riabinina et al. ...
-
bioRxiv - Neuroscience 2024Quote: ... 6-week-old Slc17a7Cre mice were injected with pAAV-EF1a-DIO-tdTomato-WPRE virus (RRID:Addgene_133786 ...
-
bioRxiv - Neuroscience 2020Quote: ... AAV1/5-CamKIIahChR2(H134R)-eYFP or AAV1/5-CamKIIa-eYFP (AAV5: from UNC GTC Vectore Core; AAV1: from Addgene) was injected bilaterally in mPFC under stereotaxic guidance at 2.2 mm anterior and 0.3 mm lateral to bregma and 1.6 mm ventral to the skull ...
-
bioRxiv - Neuroscience 2021Quote: ... 2016) (Fig. 5A, Suppl. Figs. 3C,D and 8; Salk Vector Core; 1.0 x 1012; Addgene plasmid #55636); AAV1-SynP-DIO-splitTVA-EGFP-B19G (Fig ...
-
bioRxiv - Cell Biology 2023Quote: ... were transfected with a complex of 4µg of pAAV2/8 (a gift from James M. Wilson, Addgene #112864), 4µg of pHelper (Takara Bio) ...
-
bioRxiv - Biophysics 2024Quote: ... which was a gift from Joost Snijder (Addgene plasmid #175359; #175358 http://n2t.net/addgene:175359; RRID:Addgene_175359 or 8) were used to create the scFv region ...
-
bioRxiv - Cell Biology 2020Quote: ... we generated derivatives of pCFD5:U6:3-t::gRNA (Addgene, #73914). A first derivative (pCFD5:U6:3-t::gRNA_pst-1 ...
-
bioRxiv - Genetics 2021Quote: Calu-3 cells were transduced with lenti Cas9-Blast (Addgene #52962), or with lenti dCAS-VP64_Blast (Addgene #61425) ...
-
bioRxiv - Neuroscience 2022Quote: ... a 3:1 mixture of AAV-CAG-Flex-oG (Addgene #74292) and ΔG-Rab-GFP was injected into either the GS or TA muscles of P1-P2 pups ...
-
bioRxiv - Cancer Biology 2021Quote: pcDNA3.1-Myoferlin-HA and peGFP-hGalectin-3 was purchased from Addgene (plasmid no ...
-
bioRxiv - Neuroscience 2023Quote: ... and pC-(lox2-attB2-SA-T2A-Gal4-Hsp70)3 (Addgene #62957) were gifts from Benjamin H ...
-
bioRxiv - Biochemistry 2023Quote: The plasmid used to express Cas1 and Cas2/3 (Addgene #89240) was PCR amplified with mutagenic primer pairs using Q5 polymerase (NEB ...
-
bioRxiv - Plant Biology 2023Quote: ... a C-terminal 3×FLAG® epitope tag (pICSL50007; Addgene #50308), and 3′ UTR and terminator sequences from Agrobacterium tumefaciens nopaline synthase (AtuNOST ...
-
bioRxiv - Genetics 2023Quote: ... pCFD4-U6:1_U6:3 was a gift from Simon Bullock (Addgene plasmid #49411 ...
-
bioRxiv - Microbiology 2023Quote: ... pCfB2904(XI-3 MarkerFree) was a gift from Irina Borodina (Addgene plasmid # 73276 ...
-
bioRxiv - Neuroscience 2020Quote: ... which was cloned using forward 5’TTGACTGGCGTCATTCGGGA3’ and reverse 5’TCAGGAAGATCTGGGCAAAGAG3’ primers and expressed through the pInducer20 lentiviral vector (Addgene). Western blots were performed using actin as loading control ...
-
bioRxiv - Immunology 2021Quote: ... were co-electroporated with 5 µg of either pCB92-C*05 or pEx-CAG-KIR2DL1 and 5 µg of pPhiC31o (Addgene) using the Neon transfection system (Thermo Fisher ...
-
bioRxiv - Genetics 2021Quote: ... 5 μg pT3 EF1a-MYC (Addgene plasmid # 92046) and 1 μg CMV-SB10 (Addgene plasmid # 24551 ...
-
bioRxiv - Neuroscience 2021Quote: ... 5’-entry vector pENTR5’-ubi (ubiquitin promoter) (Addgene plasmid #27230 ...
-
bioRxiv - Neuroscience 2021Quote: ... 5 µg VSV-G (pMD2.G, Addgene #12259) and 3.3 µg of plasmid of interest ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and Glut2 in pX330S-5 (Plasmid #58781, Addgene). Then ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 μg AAVS1-TALEN L plasmid (Addgene #59025), and 5mg donor plasmid (AAVS1 TREG EBdCas9 or AAVS1 TREG EBNCdCas9 ...
-
bioRxiv - Neuroscience 2021Quote: ... 5 μl of virus AAV9.CAG.GCaMP6s.WPRE.SV40 (Addgene, USA) was injected intraplantar into the left hind paw using a 10μL Hamilton syringe with a 34G needle attached ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5 μg of packaging plasmids psPAX2 (Addgene, #12260) and pCMV-VSV-G (Addgene ...
-
bioRxiv - Microbiology 2021Quote: ... pMDLg/pRRE (Addgene 658-5, 12259, 12251, 12253) to generate lentiviruses expressing ANDV or TULV N proteins ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 μg packaging plasmid pUMVC (Addgene, Plasmid #8449), 6.5 μg envelope plasmid pCMV-VSV-G (Addgene ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 μg pCAS9-mCherry-Frame+1 (Addgene #66940), and 5 μg of pCRISPR-HOT_mNEON plasmid (a kind gift from Hans Clevers ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 μg of plasmid Δ8.2 (Plasmid #8455, Addgene), and 3 μg of plasmid VSVG (Plasmid #8454 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 μg of pVSV-G (Addgene, plasmid # 8454), and 10 μg of the desired plasmid ...
-
bioRxiv - Bioengineering 2023Quote: ... together with tFucci(CA)5 plasmid29 (Addgene #153521), as per manufacture’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV2/5-hSyn-DIO-EGFP (Addgene # 50457-AAV5) or AAV2/9-Syn-DIO-EGFP (Addgene # 100043-AAV9) ...
-
bioRxiv - Genomics 2023Quote: ... and 5 μg/flask of psPAX2 (Addgene 12260) using EndoFectin Lenti transfection reagent (GeneCopoeia ...
-
bioRxiv - Immunology 2024Quote: ... with 5 µg of HA-HIF1alpha (Addgene#18949) and HA-HIF1alpha P402A/P564A-pcDNA3 (Addgene#18955) ...
-
bioRxiv - Biochemistry 2024Quote: ... and 5 ug of ATP1A1_plasmid_donor_RD (Addgene plasmid, #86551). Cells were electroporated using the Neon Transfection System (Invitrogen ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 5 µg of pMD2.G (#12259, Addgene) using Lipofectamine 2000 (#11668019 ...
-
bioRxiv - Synthetic Biology 2021Quote: Plasmids used in this work are listed in Supplementary Table 6 and are available from Addgene (identifiers listed in Supplementary Table 6).
-
bioRxiv - Cancer Biology 2021Quote: ... A doxycycline-inducible Cas9 clonal cell line of NALM-6 (using plasmid pCW-Cas9, Addgene #50661) was generated ...