Labshake search
Citations for Addgene :
1301 - 1350 of 2273 citations for 2 3 5 Dioxo 4 aza tricyclo 5.2.1.0*2 6* dec 8 en 4 yl propionic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... and inserted into two model DARPins: 1) 3G124 (anti-GFP) and 2) and Off7 (anti-MBP) and cloned into a pET vector (Addgene plasmid #29666) containing a N-terminal His-Tag ...
-
bioRxiv - Cell Biology 2023Quote: Two small gRNA (#1-GGGGTATTTCAATCAGAAGC; #2-ACGGGAAGCGCACAGTTTAT) targeting msps genomic region were synthesized and inserted into the pCFD5 vector (74) (Addgene, Plasmid #73914) via BbsI digestion ...
-
bioRxiv - Cell Biology 2022Quote: ... and 0.34 μg of viral entry protein (SARS-CoV-2 Spike, BEI #NR-53742) or pCMV-VSVG (a gift from B. Weinberg, Addgene plasmid #8454) using 8 μl of TransIT-293 (Mirus Bio #MIR 2705 ...
-
bioRxiv - Neuroscience 2024Quote: The following AAV vectors were used for channelrhodopsin-2 expression: pAAV-EF1a-double floxed-hChR2 (H134R)-EYFP-WPRE-HGHpA (Addgene plasmid #20298), pAAV-EF1a-double floxed-hChR2 (H134R)-mCherry-WPRE-HGHpA (Addgene plasmid #20297) ...
-
bioRxiv - Immunology 2024Quote: ... Trpv1-Cre mice were intraperitoneally injected on postnatal day 1 with 10uL of 2×1011 genome copies/mL AAV9-FLEX-tdTomato (Addgene, 8306-AAV9) then sacrificed for lung harvest at 6-8 weeks old ...
-
bioRxiv - Neuroscience 2024Quote: ... and the viral construct for the expression of the Ca2+ indicator GCaMP6f (n = 2, pAAV1.Syn.GCaMP6f.WPRE.SV40, Addgene, titer order of magnitude 1012) or GCaMP8s (n = 7 ...
-
bioRxiv - Neuroscience 2024Quote: ... was used to inject a total of 800 nL of a 2:18 mixture of AAV-syn-jGCaMP7s-WPRE (Addgene: 104487-AAV1) and AAV-syn-FLEX-rc[ChrimsonR-tdTomato] (Addgene ...
-
bioRxiv - Cell Biology 2024Quote: ... These cells were then transfected with 2 μg of plasmid encoding eGFP-Cre recombinase (CAG-GFP-IRES-CRE was a gift from Fred Gage, Addgene plasmid # 48201) 52 ...
-
bioRxiv - Biochemistry 2024Quote: ... The expression vector pMCSG53 encoding for the globular domain of Nsp1 SARS-CoV-2 (residues 13-127) with an N-terminal His-tag followed by the Tev-cleavage site was obtained from Addgene (catalog # 167256) and described in (13) ...
-
bioRxiv - Cell Biology 2024Quote: ... 25 ng/µl of pTN26 and 5 ng/µl of pTN27 were injected into the gonad of N2 animals with the control injection markers pCFJ90 (Pmyo-2::mCherry, Addgene #8984,[86]) and pCFJ104 (Pmyo-3::mCherry ...
-
bioRxiv - Cell Biology 2024Quote: The following plasmids were used for plasmid construction: for SARS-CoV-2 pGBW-m4134905 was a gift from Ginkgo Bioworks & Benjie Chen (Addgene plasmid # 151966), for HCoV-OC43 pGBW-m4134899 was a gift from Ginkgo Bioworks & Benjie Chen (Addgene plasmid # 151902) ...
-
bioRxiv - Cell Biology 2024Quote: ... guide RNA 5’-AAGCTCAGAATCAGTCCGGG-3’ targeting exon 2 of Kif3B was designed in Benchling and cloned into the pX330 Cas9 plasmid (gift from Feng Zhang; Addgene plasmid #42230)80 ...
-
bioRxiv - Neuroscience 2022Quote: ... A pcDNA3 flag HA 14-3-3 β plasmid was a gift from William Sellers (Addgene plasmid # 8999 ...
-
bioRxiv - Cell Biology 2023Quote: ... and let-858 3’ UTR and mKate::HA::let-858 3’UTR from pDD287 (Addgene #70685). Correct sequences of constructed plasmids were confirmed with Sanger sequencing ...
-
bioRxiv - Neuroscience 2021Quote: ... or AAV5-hSyn-DIO-hM4D(Gi)-mCherry (≥8 × 1012vg/mL, Addgene #44362). The needle remained in place for an additional 5 minutes after each injection to allow for diffusion of the virus and then the needle was slowly removed from the brain ...
-
bioRxiv - Neuroscience 2024Quote: ... rAAV5-hsyn-mCherry-WPRE (Addgene #114472, Titer: 8 x 1012 GC/mL) was injected unilaterally (60-100 nL at 40 nL/min ...
-
bioRxiv - Neuroscience 2024Quote: ... Then either pAAV2/8-hSyn-FLEX-TeLC-P2A-EYFP-WPRE72 (Addgene, #135391), a gift from Bernando Sabatini’s Lab ...
-
bioRxiv - Bioengineering 2022Quote: ... 3 μg pMD2.G (Addgene #12259), 12 μg pCMV delta R8.2 (Addgene #12263) ...
-
bioRxiv - Cell Biology 2021Quote: ... mEmerald-ER-3 (Addgene plasmid #54082), and calnexin-mEmerlad (Addgene plasmid #54021 ...
-
bioRxiv - Cell Biology 2021Quote: ... and 3 μg pMD2.G (Addgene) were transfected into 293T cells at 80% confluency in a 10-cm dish with 8 ml of media ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 μg psPax vector (Addgene #12260), 1.5 μg pMD2.G vector (Addgene #12259 ...
-
bioRxiv - Cell Biology 2021Quote: ... or Galectin-3-GFP (Addgene; [48]). The bacterial expression vector pZsGreen (Takara Bio USA ...
-
bioRxiv - Cell Biology 2021Quote: ... pCFJ104 (Pmyo-3::mCherry, Addgene #19328) and pGH8 (Prab-3::mCherry ...
-
bioRxiv - Bioengineering 2021Quote: ... 3 µg pMD2.G (Addgene #12259) and 9 µg lentiviral vector were diluted in 1.2 mL OptiMEM ...
-
bioRxiv - Developmental Biology 2021Quote: ... U6-1 and U6-3 (Addgene plasmid #83954 ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 3 μg psPAX2 (Addgene #12260) using Lipofectamine 3000 (Life Technologies ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3 µg of psPAX2 (Addgene #12260), and 1.5 µg of the pMD2.G plasmid (Addgene #12259 ...
-
bioRxiv - Cell Biology 2024Quote: ... and 3 μg psPAX2 (AddGene 12260) using Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Biochemistry 2023Quote: ... mCherry-ER-3 (Addgene, Watertown, MA), or Perilipin1-YFP[41] following established protocols[32] ...
-
bioRxiv - Cell Biology 2024Quote: ... and 3 μg pMD2.G (Addgene) were transfected into 293T cells at 80% confluency in a 10-cm dish with 8 ml of media ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV2/5: pAAV2/5 was a gift from Melina Fan (Addgene plasmid # 104964 ...
-
bioRxiv - Developmental Biology 2022Quote: ... and then were inserted into pBP-Gal80Uw-6 (#26236, Addgene) via an L-R reaction with GATEWAY LR clonase II plus enzyme mix (12538120 ...
-
bioRxiv - Developmental Biology 2023Quote: ... EGFP-Tubulin-6 was a gift from Michael Davidson (Addgene plasmid # 56450 ...
-
bioRxiv - Molecular Biology 2024Quote: ... 6 μg of the psPAX2 plasmid (Addgene plasmid no. 12260) and 0.6 μg of the pMD2.g plasmid (Addgene ...
-
bioRxiv - Neuroscience 2024Quote: ... 6 µg of the envelope plasmid pMD2.G (Addgene #12259), and 6 µg the transfer plasmid pLVX-UbC-rtTA-Ngn2:2A:Ascl1 (Addgene #127289 ...
-
bioRxiv - Cell Biology 2022Quote: ... with AgeI and BstBI restriction sites into the pLenti CMV/TO GFP-MDC1 (779-2) (plasmid #26285, Addgene, gift from E. Campeau; Genewiz) backbone ...
-
bioRxiv - Cell Biology 2020Quote: ... SKO cells were transfected with pSH-EFIRES-P-GFP(1-10)opti AAVS1 Safe Harbor integration plasmid (Addgene plasmid # 129416, [35] and pCas9-sgAAVS1-2 (Addgene plasmid # 129727 [47]), and a stable pool was selected using puromycin (1 µg/ml puromycin for 6 days ...
-
bioRxiv - Cancer Biology 2020Quote: pBABE-SAOS 2 and hTERT-SAOS 2 stable cell lines were obtained upon transfection of the SAOS 2 cell line with the plasmids pBABE-puro or pBABE-puro-hTERT from Addgene (#1764, #1771, respectively), and Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: Plasmids encoding the SARS-CoV-2 open reading frames proteins and eGFP control were a kind gift of Nevan Krogan (Addgene plasmid #141367-141395). Plasmids were acquired as bacterial LB–agar stabs ...
-
bioRxiv - Neuroscience 2022Quote: ... All cell lines presented in this study are available from the corresponding author upon request and all plasmids are available from Addgene (Supplementary Table 2).
-
bioRxiv - Cancer Biology 2020Quote: ... HEK293T cells were transfected with psPAX2 and pMDG.2 packaging plasmids (gifts from Didier Trono, EPFL, Lausanne, Switzerland; Addgene plasmids 12559 and 12660) and the lentiviral expression construct ...
-
bioRxiv - Microbiology 2022Quote: ... were cloned from pLVX- EF1alpha-SARS-CoV-2-M-2xStrep-IRES-Puro and pLVX-EF1alpha-SARS-CoV-2-E-2xStrep- IRES-Puro (kind gifts from Nevan Krogan, available from Addgene #141386 and #141385) using PCR to remove the 2xStrep epitope tag ...
-
bioRxiv - Neuroscience 2020Quote: One adult mouse (~ 2 months) was stereotaxically injected with a GCaMP6f construct (AAV5.CamKII.GCaMP6f.WPRE.SV40 virus, Addgene # 100834; 0.4 μL at 0.06 μl/min) in hippocampal CA1 ...
-
bioRxiv - Cancer Biology 2021Quote: ... HEK293T cells were transfected with psPAX2 and pMDG.2 packaging plasmids (gifts from Didier Trono, EPFL, Lausanne, Switzerland; Addgene plasmids 12559 and 12660), the lentiviral expression plasmid ...
-
bioRxiv - Neuroscience 2024Quote: ... Wild-type animals were then injected whether with mix 1 or mix 2 or AAV9-CamKII-GCaMP6f-WPRE-SV40 (Addgene, 100834, vg/mL) or AAV9-CamKII-hM4D(Gi)-mCherry (construct provided by Bryan Roth ...
-
bioRxiv - Biophysics 2022Quote: The plasmid encoding GPCR kinase subtype 2 used for the receptor phosphorylation in insect cells (GRK2-CAAX) was a gift from Robert Lefkowitz (Addgene plasmid #166224 49). Full-length arrestin21-418 (C150L ...
-
bioRxiv - Cancer Biology 2022Quote: ... shNFATC2IP#2: ACATTTGCTTGAGGCTTATAC) were cloned into Tet-pLKO-puro or TET-pLKO-neo vectors (gifts from Dmitri Wiederschain, Addgene plasmids #21915 and #21916). Hairpins were introduced by lentiviral transduction using pRSV-Rev (Addgene plasmid # 12253) ...
-
bioRxiv - Cell Biology 2023Quote: ... and EBP50-PDZ12 (aa 1-298) cloned into the pCMV-2-FLAG vector were gifts from Maria-Magdalena Georgescu (Addgene plasmids #28291-28297).
-
bioRxiv - Cell Biology 2020Quote: ... Mouse Mannosidase II amino acids 1-116 was amplified from Addgene plasmid #65261 using a forward primer that contains an XbaI site and a reverse primer with an MluI site and further subcloned upstream of the mCherry open reading frame.
-
bioRxiv - Neuroscience 2023Quote: ... and ectodomain (52-750 amino acids) of the NEP (#7283, Addgene) were used for the fusion protein and then inserted in rAAA-FLEX-axonGCaMP6s-P2A-mRUBY3 vector (#112008 ...