Labshake search
Citations for Addgene :
101 - 150 of 429 citations for Phosphatidylinositol N acetylglucosaminyltransferase subunit Q PIGQ Antibody HRP since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... encoding a TEV cleavable N-terminal His6-tag (RRID: Addgene_228880 ...
-
bioRxiv - Developmental Biology 2024Quote: ... and FSW-HRP-V5-LRRTM2 (Alice Ting, Addgene, #82537) plasmids ...
-
bioRxiv - Immunology 2023Quote: ... N-MLV reporter viruses were generated by transfection of a three-plasmid system: pCIG3-N for expression N-MLV gag/pol (Addgene #132941, a gift from Jeremy Luban) [50] ...
-
bioRxiv - Biophysics 2020Quote: ... containing N-terminal 6-His-WT-p53 (1-303) (Addgene, 24859), was used to express p53 ...
-
bioRxiv - Immunology 2021Quote: ... or 2C-T (AmpR, N-terminal His6-MBP fusion; Addgene #29706). Plasmids were transformed into E ...
-
bioRxiv - Neuroscience 2020Quote: ... full name AAV-EF1a-DIO-trkB.DN-TM570-mCherry (Addgene, n°121502), was constructed by PCR amplification of rat truncated trkB.T1 with the sequence downstream of the transmembrane domain replaced by the sequence of three alanine residues followed by a stop codon (from the plasmid pLTM570 ...
-
bioRxiv - Microbiology 2021Quote: ... a pHAGE N-mNeonGreen IRES puro was also generated (Addgene #170467).
-
bioRxiv - Cell Biology 2022Quote: ... N-terminal IBAR genes were cloned into Cry2PHR-mCherry (Addgene #26866) using NheI and XhoI restriction sites (Kennedy et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... pZac2.1-hSynapsin1::NAPA-N SV40 (gift from Baljit Khakh, Addgene #92282) (titer ...
-
bioRxiv - Neuroscience 2021Quote: ... mEos3.2-Homer1-N-18 was a gift from Michael Davidson (Addgene plasmid # 57461 ...
-
bioRxiv - Biophysics 2022Quote: ... pCMV-mApple-MyosinIIA-N-18 (Addgene #54930, gift from Michael Davidson), and pEGFP internal GFP Ezrin (gift from Florence Niedergang).
-
bioRxiv - Cell Biology 2020Quote: ... and mCherry-Cx43-N-7 were gifts from Michael Davidson (Addgene plasmids # 55112 ...
-
bioRxiv - Physiology 2020Quote: ... the mouse N-Shh sequence was then cloned in pRRLsin.MND.MCS.WPRE (Addgene) that had been previously digested by NheI and PmlI ...
-
bioRxiv - Cell Biology 2022Quote: ... construct was cloned into a pLVpuro-CMV-N-EGFP (Addgene, #122848) lentivirus plasmid using the gateway system (ATTB sites were added at the Paxillin-peGFP plasmid using the primers ...
-
bioRxiv - Molecular Biology 2023Quote: N-terminal histidine tagged wild-type VCP was obtained from Addgene (plasmid #12373 ...
-
bioRxiv - Molecular Biology 2023Quote: ... pLVpuro-CMV-N-EGFP was a gift from Robin Ketteler (Addgene plasmid # 122848 ...
-
bioRxiv - Biochemistry 2023Quote: ... or N-terminal His10-MBP Tag (2CT-10; Addgene Plasmid #37237) were chosen as the MBP tag has been shown to increase the solubility of select proteins [9] ...
-
bioRxiv - Immunology 2023Quote: pcDNA3-N-Flag-NLRP3 plasmid encoding mouse NLRP3 (Addgene plasmid # 75127) was a gift from Bruce Beutler61 ...
-
bioRxiv - Biochemistry 2023Quote: ... pDEST-CMV-N-EGFP was a gift from Robin Ketteler (Addgene plasmid # 122842 ...
-
bioRxiv - Biophysics 2022Quote: ... pCMV-mCherry-FilaminA-N-9 (Addgene #55047, gift from Michael Davidson), pCMV-mEmerald-Alpha-Actinin-19 (Addgene #53989 ...
-
bioRxiv - Cell Biology 2023Quote: ... Ad-mApple-TOMM20 derived from mApple-TOMM20-N-10 (Addgene #54955), Ad-EGFP-BNIP3 ...
-
bioRxiv - Cancer Biology 2023Quote: ... we initially electroporated with a pCAGGS-mCherry plasmid (Addgene n°41583) in CNC or TNC cells at 7ss and 14ss ...
-
bioRxiv - Developmental Biology 2024Quote: ... The gene sequences encoding N-terminally mCherry tagged Drp1 (Addgene, 49152) were inserted between the EcoRI and PstI sites of the pCDNA vector (mCherry-Drp1) ...
-
bioRxiv - Neuroscience 2024Quote: ... pGW-HA.attB 37 or pDEST-CMV-N-EGFP (Addgene Plasmid #122842) respectively using the Gateway LR Clonase reaction (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... Alice Ting (Stanford University): FSW-HRP-V5-LRRTM1 (Addgene #82536), FSW-HRP-V5-LRRTM2 (Addgene #82537 ...
-
bioRxiv - Developmental Biology 2021Quote: ... N-terminal KRAB-dCas9 (a gift from Bruce Conklin, Addgene plasmid # 73498) fused with a destabilising domain ...
-
Rhes protein transits from neuron to neuron and facilitates mutant huntingtin spreading in the brainbioRxiv - Neuroscience 2021Quote: ... pEGFP-N-Drd1 plasmid was a gift from Kirk Mykytyn (Addgene, 104358), GFP-DRD2 plasmid was a gift from Jean-Michel Arrang (Addgene ...
-
bioRxiv - Biochemistry 2021Quote: ... pLPC-puro-N-Flag was a gift from Titia de Lange (Addgene plasmid # 12521 ...
-
bioRxiv - Cell Biology 2021Quote: ... The resulting PCR product was inserted into pLVpuro-CMV-N-EGFP (Addgene plasmid # 122848 ...
-
bioRxiv - Neuroscience 2020Quote: ... Sham animals included virgins injected with halorhodopsin (AAV1.CaMKIIa.eNpHR.EYFP; Addgene; N=1) that received no optical stimulation ...
-
bioRxiv - Cancer Biology 2022Quote: ... DCX DNA was cloned into the N-Terminal pFLAG 3 vector (Addgene) by restriction digest using NotI and BamHI restriction enzymes ...
-
bioRxiv - Cell Biology 2020Quote: ... mApple-SSTR3-N-17 was a gift from Michael Davidson (Addgene # 54949). SSTR3 was shuttled into CSII-EF lentiviral vector into XhoI/XbaI site by Gibson cloning using the primers aacacgctaccggtctcgagaattcatggccactgttacctatcctt and tgctcaccatcagatggctcagtgtgctgg for SSTR3 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and pcDNA3-RLUC-POLIRES-FLUC (a gift from N. Sonenberg; Addgene #45642) (Poulin et al. ...
-
bioRxiv - Microbiology 2020Quote: ... pCAG-VSV-N (#64087) and pCAGGS-T7Opt (#65974) were ordered from Addgene. S expressing pCAGGS vectors were used for the production of pseudoviruses ...
-
bioRxiv - Neuroscience 2023Quote: ... or AAV8-hSyn-DIO-GFP (Addgene, n=8, 4 male, 4 female) were injected bilaterally into the BNST (5 × 1012 titer ...
-
bioRxiv - Cancer Biology 2022Quote: ... FRA1 sequence from p6599 MSCV-IP N-HAonly FOSL1 vector (Addgene, 34897) was cloned into pLV-EF1α-IRES-puro vector (Addgene ...
-
bioRxiv - Molecular Biology 2024Quote: ... the SMARCAL1 coding sequence was cloned into pLEX_305-N-dTAG (Addgene #91797) by the Gateway system (Life Technologies/Thermo Fisher ...
-
LRBA balances antigen presentation and T-cell responses via autophagy by binding to PIK3R4 and FYCO1bioRxiv - Immunology 2024Quote: ... pVitro-hygro-N-myc-hVps34/Vps15-C-V5-his-plasmid (Addgene #24055), pEGFP-Atg14L (Addgene #21635 ...
-
bioRxiv - Neuroscience 2024Quote: ... or GCaMP8s (n = 7, pAAV1.Syn.GCaMP8s.WPRE, Addgene, titer order of magnitude 1012) was pressure ejected at 4 sites ∼200 μm below the dura (25 nl each ...
-
bioRxiv - Genomics 2024Quote: ... (pLEX_305-N-dTAG was a gift from James Bradner & Behnam Nabet (Addgene plasmid # 91797 ...
-
bioRxiv - Cell Biology 2020Quote: ... Each transfection consisted of 250 ng expression plasmid (pcDNA3-control (Addgene; n/a), pcDNA3-Sox2FLAG (homemad) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... the mEmerald tag was PCR amplified from mEmerald-PLK1-N-16 vector (Addgene #54234 ...
-
bioRxiv - Biophysics 2021Quote: ... was a gift from Michael Davidson (mApple-MAPTau-N-10, Addgene plasmid # 54925). Using the QuikChange II XL Site-Directed Mutagenesis kit (Agilent ...
-
bioRxiv - Cancer Biology 2021Quote: Cells were transfected overnight in 10cm plates with N-GFP-RelA (Addgene #23255) or C-Flag-Rela (Addgene #20012 ...
-
bioRxiv - Cell Biology 2020Quote: mRuby2-MannII-N-10 was a gift from Michael Davidson (Addgene plasmid # 55903)(83) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... a chimeric coding sequence consisting of an N’-terminal HiBit (pEPYC0CM0258, Addgene T.B.C.) the uidA coding sequence ...
-
bioRxiv - Genetics 2020Quote: ... Dapi labelled the nuclei and m-Cherry-TNGP-N-10 (Addgene, Cat # 55145) localized the Golgi ...
-
bioRxiv - Cell Biology 2022Quote: ... The MAP4K4 sequence was cloned into a pLVpuro-CMV-N-EGFP (Addgene, #122848) lentiviral plasmid using the gateway system ...
-
bioRxiv - Microbiology 2023Quote: ... The codon-optimized HCoV-OC43 N sequence was amplified from plasmid # 151960 (Addgene) with primers HCoV-OC43-N c-opt(pLVX)_Fw (gaattcgccgccaccatgtccttcaccccggg ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV8-hSyn-DIO-hM4D(Gi)-mCherry (Addgene, n=8, 4 male, 4 female) or AAV8-hSyn-DIO-GFP (Addgene ...