Labshake search
Citations for Addgene :
1 - 50 of 429 citations for Phosphatidylinositol N acetylglucosaminyltransferase subunit Q PIGQ Antibody HRP since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2023Quote: Full length plasmid of PI3KCA (phosphatidylinositol-4,5-biphosphate 3-kinase catalytic subunit alpha, NM_006218.4) was purchased from Addgene (Plasmid ID: 81736, Hahn and Root Lab). The coding sequence of PI3KCA was cloned into Lenti-PCDH-EF1-mNeonGreen-MCS-T2A-puromycin plasmid (a kind gift from Fırat-Karalar Lab ...
-
bioRxiv - Neuroscience 2020Quote: ... rat α2δ1 subunit (Addgene, accession number AF286488), and the zebrafish β4b subunit (accession number KC192785) ...
-
bioRxiv - Biochemistry 2023Quote: ... sapiens SUV39H2 catalytic subunit (Addgene plasmid #25115) Escherichia coli expression plasmids used in this study were acquired from Addgene ...
-
bioRxiv - Cell Biology 2022Quote: A His-tagged mouse Capping Protein (F-actin-capping protein subunit alpha-1 and F-actin-capping protein subunit beta) plasmid was obtained from Addgene as described above (Plasmid #89950) ...
-
bioRxiv - Biochemistry 2023Quote: The Homo sapiens EHMT1 catalytic subunit (Addgene plasmid #51314) and H ...
-
bioRxiv - Biophysics 2024Quote: ... and γ subunits were gifts from Christie Thomas (Addgene plasmid # 83430 ...
-
bioRxiv - Cell Biology 2021Quote: Exocyst subunit plasmids were a kind gift from Channing Der (Addgene 53755-53762) (73) ...
-
bioRxiv - Molecular Biology 2024Quote: ... the epsilon subunit of the bacterial FoF1-ATP synthase cDNA (Addgene plasmid #113906) was inserted into mTQ2-pRSET-A plasmid at Tyr-145 (between the KpnI and EcoRI restriction sites ...
-
bioRxiv - Physiology 2024Quote: ... encoding the NMDAR-NR1 subunit tagged with an enhanced yellow protein (EYFP) (Addgene plasmid #17928 ...
-
bioRxiv - Biochemistry 2024Quote: Exocyst subunit plasmids were a kind gift from Channing Der (Addgene #53755-53762). Each was subcloned into FlexiBAC SF9 expression plasmids61 ...
-
bioRxiv - Neuroscience 2020Quote: ... GABA (A) receptor subunit a1SE was a gift from Tija Jacob & Stephen Moss (Addgene plasmid # 49168 ...
-
bioRxiv - Cancer Biology 2023Quote: Each individual Mediator subunit was cloned and expressed in a pLIB plasmid (Addgene #80610). MED12 ...
-
bioRxiv - Physiology 2024Quote: ... encoding the NMDAR-NR2B subunit tagged with an enhanced green fluorescent protein (EGFP) (Addgene plasmid #17925 ...
-
bioRxiv - Biochemistry 2020Quote: pHA#843: hrp-1p∷hrp-1HsLCΔLC∷hrp-1 3’UTR (Addgene ID: 139200)
-
bioRxiv - Biochemistry 2020Quote: pHA#841: hrp-1p∷hrp-1HsLCWT∷hrp-1 3’UTR (Addgene ID: 139198)
-
bioRxiv - Biochemistry 2020Quote: pHA#842: hrp-1p∷hrp-1HsLCD290V∷hrp-1 3’UTR (Addgene ID: 139199)
-
bioRxiv - Microbiology 2021Quote: ... N (Addgene # 64087), P (Addgene # 64088) ...
-
bioRxiv - Immunology 2021Quote: ... Plasmid encoding EGFP-tagged PP1 catalytic subunit γ was obtained from Addgene (Addgene plasmid # 44225). Expression of PTSN was silenced in U2-OS and 293A cells by lentiviral transduction of a pLKO1 shRNA against both β- and α-PTSN (TRCN0000282572 ...
-
bioRxiv - Cell Biology 2022Quote: ... YFP was inserted into TM3-TM4 intracellular loop of the α4 subunit (Addgene, catalog #: 15245), and cerulean (a CFP variant ...
-
bioRxiv - Bioengineering 2021Quote: ... the sequence encoding the PE2 N terminus (PE2-N term) (Addgene #132775) and a splicing donor (SD ...
-
bioRxiv - Cancer Biology 2021Quote: ... N-Myc (Addgene #74163) was cloned into plasmid pcDNA5/FRT/TO (Thermo Fisher Scientific ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... The WT human α4 and β1 subunits were subcloned into the pUNIV vector (Addgene, Cambridge, MA, USA) and the human δ-subunit into the pcDNA5/FRT vector (Invitrogen ...
-
bioRxiv - Cell Biology 2022Quote: ... 65]: CFP was inserted into the TM3-TM4 intracellular loop of the β2 subunit (Addgene, catalog #: 15106), YFP was inserted into TM3-TM4 intracellular loop of the α4 subunit (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV9-hSyn- GrabDA1h (n = 5 Area X hemispheres; n = 2 MST hemispheres; Addgene), AAV5-CAG- Dlight1.1 (n = 1 Area X hemisphere ...
-
bioRxiv - Molecular Biology 2021Quote: ... N-terminal FKBP12F36V fragments were originally amplified originally from pLEX_305-N-dTAG (Addgene #91797) (Nabet et al. ...
-
bioRxiv - Molecular Biology 2024Quote: ... FP-SARS-N (Addgene, #153201) was used as the positive control for copy number calculation.
-
bioRxiv - Cell Biology 2024Quote: ... GFP-N-TFEB (38119, Addgene) and its corresponding control (60360 ...
-
bioRxiv - Cell Biology 2024Quote: ... pcDNA3-N-HA-NEK7 and pcDNA3-N-HA-NEK7K64M were gifts from Bruce Beutler (Addgene plasmid # 75142 ...
-
bioRxiv - Cell Biology 2020Quote: ... The plasmid containing the α1C subunit (CaV1.2) of L-type Ca2+ channels was a gift from Diane Lipscombe (Addgene plasmid # 26572 ...
-
bioRxiv - Neuroscience 2020Quote: ... receptor subunit a1SE was a gift from Tija Jacob & Stephen Moss (Addgene plasmid # 49168; http://n2t.net/addgene:49168; RRID: Addgene_49168). Rat GABAAα1 (NM_183326 ...
-
bioRxiv - Biochemistry 2021Quote: ... we transfected HEK293T cells with Cas9 and sgRNA targeting the gene encoding for the CCT5 subunit (Addgene eSpCas9(1.1) vector ...
-
bioRxiv - Biochemistry 2020Quote: pHA#849: mec-4p∷hrp-1HsLCD290VmScarlet∷hrp-1 3’UTR (Addgene ID: 139203)
-
bioRxiv - Biochemistry 2020Quote: pHA#848: mec-4p∷hrp-1HsLCWTmScarlet∷hrp-1 3’UTR (Addgene ID: 139202)
-
bioRxiv - Biochemistry 2020Quote: pHA#847: mec-4p∷hrp-1mScarlet∷hrp-1 3’UTR (Addgene ID: 139201)
-
bioRxiv - Cell Biology 2023Quote: ... N-terminal HA-tagged full-length pCGN-ATF6-N plasmid came from Addgene (catalog #: 11974, human). The XBP1s plasmid was a kind gift from Dr ...
-
bioRxiv - Plant Biology 2020Quote: ... pAG426GAL_eGFP_ccdB (Addgene; N-terminal GFP fusions) or pAG426GAL_ccdB_eGFP (Addgene ...
-
bioRxiv - Cell Biology 2020Quote: The pcDNA3-Shh (N) (Addgene, #37680) was used as template to amplify the cDNA coding residues 24-197 of mouse Shh ...
-
bioRxiv - Cell Biology 2021Quote: ... mEmerald-actin-N-10 (Addgene #53979), mEmerald-actin-C-18 (Addgene #53978) ...
-
bioRxiv - Immunology 2023Quote: ... pcDNA3-N-Flag-ASC1 (Addgene, #75134) plasmid was used ...
-
bioRxiv - Microbiology 2020Quote: The integrins subunits were overexpressed in CHO cells line with the following plasmids: Alpha 5 integrin-GFP (Addgene plasmid# 15238)50 ...
-
bioRxiv - Microbiology 2022Quote: ... cells were immortalised using the catalytic subunit of hTERT delivered by transduction using a lentivirus vector (pLV-hTERT-IRES-Hygro; Addgene). Two days post-transduction ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The N-terminus fusion plasmid pDN0605 was constructed using pDEST-DHFR F[1,2]-N (TRP1) (Addgene #177797) (Evans-Yamamoto et al ...
-
bioRxiv - Neuroscience 2024Quote: ... n=2) or AAV9.EF1a.dflox.hChR2(H134R).EYFP.WPRE.HGH (1×10^12 pp/mL, Addgene, cohort 2, n=2). Subject mice were additionally injected in vCA2 (AP −3.0 ...
-
bioRxiv - Cell Biology 2022Quote: ... The Capping Protein (F-actin-capping protein subunit alpha-1 and F-actin-capping protein subunit beta) plasmid was a gift from Antoine Jégou & Guillaume Romet-Lemonne (Addgene plasmid #89950).
-
bioRxiv - Bioengineering 2020Quote: The following sequence for the I-Adα.TCRα chimeric CRMpMHCIIα subunit was subcloned into the pMSCV-ires-CFP II (gift from Dario Vignali, Addgene plasmid # 52109) via 5’EcoRI and 3’XhoI: gaattccgccaccatgccgtgcagcagagctctgattctgggggtcctcgccctgaacaccatgctcagcctctgcggaggtgaagacgacattgaggccgaccacgtaggcttctatggtacaactgtttatcagtctcctggagacattggccagtacacacatgaatttgatggtgatgagttgttctatgtggacttggataagaagaaaactgtctggaggcttcctgagtttggccaattgatactctttgagccccaaggtggactgcaaaacatagctgcagaaaaacacaacttgggaatcttgactaagaggtcaaatttcaccccagctaccaatgaggctcctcaagcgactgtgttccccaagtcccctgtgctgctgggtcagcccaacacccttatctgctttgtggacaacatcttcccacctgtgatcaacatcacatggctcagaaatagcaagtcagtcacagacggcgtttatgagaccagcttcctcgtcaaccgtgaccattccttccacaagctgtcttatctcaccttcatcccttctgatgatgacatttatgactgcaaggtggagcactggggcctggaggagccggttctgaaacactgggaacctgagattccagcccccatgtcagagctgacagaaactgtgtgtgatgccacgttgaccgagaaaagctttgaaacagatatgaacctaaactttcaaaacctgtcagttatgggactccgaatcctcctgctgaaagtagcgggatttaacctgctcatgacgctgaggctgtggtccagttgactcgag
-
bioRxiv - Cell Biology 2021Quote: ... mEmerald-mDia1-N-14 (Addgene plasmid #54157), mEmerald-mDia2-N-14 (Addgene plasmid #54159) ...
-
bioRxiv - Cell Biology 2021Quote: ... mEmerald-mDia2-N-14 (Addgene plasmid #54159), and mRuby-LifeAct-7 (Addgene plasmid #54560 ...
-
bioRxiv - Microbiology 2021Quote: ... mEmerald-mDia1-N-14 (Addgene plasmid#54157), mEmerald-mDia2-N-14 (Addgene plasmid #54159) ...
-
bioRxiv - Microbiology 2021Quote: ... mEmerald-mDia2-N-14 (Addgene plasmid #54159), and mRuby-LifeAct-7 (Addgene plasmid#54560 ...
-
bioRxiv - Immunology 2020Quote: Emerald-Dectin1A-N-10(Addgene plasmid, #56291), Emerald-Dectin1A-C-10 (Addgene plasmid # 54057) ...