Labshake search
Citations for Addgene :
101 - 150 of 1428 citations for Mouse Eukaryotic translation initiation factor 4E binding protein 3 EIF4EBP3 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... mCherry-ER-3 (Addgene, Watertown, MA), or Perilipin1-YFP[41] following established protocols[32] ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3 µg of psPAX2 (Addgene #12260), and 1.5 µg of the pMD2.G plasmid (Addgene #12259 ...
-
bioRxiv - Cell Biology 2019Quote: The Polo-like binding domain (PBD) of PLK1 (amino acid 326 to amino acid 603) was amplified from the pTK24 plasmid (Addgene) and cloned into a pT7-His6-SUMO expression vector using NEB Gibson assembly (Gibson Assembly Master Mix ...
-
bioRxiv - Neuroscience 2021Quote: ... The amplified fragments were inserted using KpnI and MluI sites into the pCAG vector backbone containing a zinc-finger binding site upstream of a CAG promoter prepared from pCAG-GPHN.FingR-EGFP-CCR5TC (Addgene #46296)17.
-
bioRxiv - Pathology 2021Quote: ... of adeno-associated virus serotype 8 encoding Cre recombinase under the hepatocyte-specific thyroid binding globulin promoter (AAV8-TBG-Cre) (Addgene) followed by a 12 days (12d ...
-
bioRxiv - Physiology 2021Quote: ... Adeno-associated virus serotype 8 (AAV8) with the thyroxine-binding globulin promoter (TBG) promoter expressing Cre (Addgene, AV-8-PV1091) were injected via tail vein at a dose of 1×1012 genomic copies per mouse on GD8 ...
-
bioRxiv - Genomics 2022Quote: ... was used to generate a list of all primers with one exact-match binding site on one of the plasmids and no exact-match binding site on the other plasmid (pcDNA3-EGFP and pLTR-RD114A from Addgene). The first round of experimental amplification used 204 primers from this list that maximized the variability in the 22 primer attributes in Table 2 ...
-
bioRxiv - Cell Biology 2022Quote: ... The pGEX2TK-Pak1 (70-117) containing the p21-binding domain (PBD) was a gift from Jonathan Chernoff (Addgene plasmid# 12217). For the purification of ARP3 (ACTR3) ...
-
bioRxiv - Plant Biology 2023Quote: The monocot nlsGPS-NR control sensor amino acid sequence contains the same four charge exchange mutations as the nlsGPS2 but with the additional NR mutations (S114A and F115A in the AtGID1C binding pocket). DR5v2-ntdTomato/DR5-n3GFP and R2D2 were previously described (Liao et al. 2015) and obtained from Addgene (DR5v2/DR5 catalog #61628 ...
-
bioRxiv - Plant Biology 2024Quote: ... For N-terminal fusions with the GAL4-activation or -binding domains the vectors pGADT7-GW and pGBKT7-GW (gift from Yuhai Cui, Addgene plasmids #61702 ...
-
bioRxiv - Cell Biology 2024Quote: ... we received plasmids encoding WT SARS-CoV-2 SP (Wuhan-Hu-1) and its receptor binding domain (RBD) from Addgene under a Material Transfer Agreement ...
-
bioRxiv - Cancer Biology 2024Quote: ... dominant negative N133I (GFP-Rab27B N133I, Adddgene plasmid #89449, and geranylgeranyl-binding mutant (GER) (GFP-Rab27B GG, Addgene plasmid #89451) were gifted by Wendy Westbroek (Reference) ...
-
bioRxiv - Cell Biology 2022Quote: A His-tagged mouse Capping Protein (F-actin-capping protein subunit alpha-1 and F-actin-capping protein subunit beta) plasmid was obtained from Addgene as described above (Plasmid #89950) ...
-
bioRxiv - Cell Biology 2022Quote: ... annealed oligo (5’-CACCGATGACCAACGACGCAAGTTT-3’ and 5’-AAACAAACTTGCGTCGTTGGTCATC-3’) was inserted into PX459 (pSpCas9(BB)-2A-PuroV2.0) (Addgene) (Ran et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... The entire coding sequence of GCaMP6s was amplified by PCR with primers 5’–GGATCCGCCACCATGGGTTCTCATCATCATCA–3’ and 5’–GTAGCCGAACCGGTCTTCGCTGTCATCATTTGTAC–3’ using pGP-CMV-GCaMP6s (Addgene plasmid # 40753; http://n2t.net/addgene:40753; RRID:Addgene_40753) as a template ...
-
bioRxiv - Neuroscience 2020Quote: ... Lin Tian)56 using Q5 polymerase (primers: 5’-aaaagctagcatgaagacgatcatcgccctgagc-3’ and 5’-aaaaaggcgcgcctcaggttgggtgctgaccg-3’) and subcloned into pAAV.CBA.DIO (Addgene #81008)108 backbone between AscI and NheI restriction sites ...
-
bioRxiv - Biochemistry 2022Quote: ... The wild-type 14-3-3 ζ gene was cloned into NcoI/XhoI digested pBAD plasmid (Addgene #85482) with a TEV cleavable C-terminal His6 purification tag ...
-
bioRxiv - Molecular Biology 2023Quote: gRNAs targeting LSM14A (5’-TCTGTACCAAAGGATCGAAC-3’) and XRN1 (5’-AGAGAAGAAGTTCGATTTGG-3’) were cloned into LentiCRISPR v2 (Addgene #52961) using BsmBI restriction enzyme sites and confirmed by sequencing ...
-
bioRxiv - Neuroscience 2023Quote: ... neonatal Swiss Webster or C57Bl/6 (P0–3) mice were anesthetized on ice for 3 min before injecting viral vectors (AAV5.GfaABC1D.GCaMP6f.SV40 [Addgene, 52925-AAV5] ...
-
bioRxiv - Neuroscience 2022Quote: ... the complementary DNA (cDNA) for each iMN factor (Ngn2, Lhx3, Isl1, NeuroD1, Ascl1, Brn2 and Myt1l) was purchased from Addgene and cloned into the pMXs retroviral expression vector using Gateway cloning technology (Invitrogen) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... A human elongation factor 1 (EF1) promoter was introduced using a Gateway att4-att1 Entry clone (Addgene, Watertown, MA, #162920). Final expression clones were verified by restriction analysis and maxiprep DNA was prepared using the Qiaprep Maxiprep kit (Qiagen ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Three elements of the reporter were amplified from the following sources: five TetO binding sites upstream of a pEF promoter from PhiC31-Neo-ins-5xTetO-pEF-H2B-Citrine-ins (Addgene #78099), TagRFP-T from pEN_ERK.KTR-tagRFP-T ...
-
bioRxiv - Cell Biology 2021Quote: ... the cytosolic domain of Miro1 (Miro1(ΔTM)) and the iLID binding peptide (SspB, obtained from Addgene #60415, gift from B. Kuhlman) were fused into pmCherry-C1 using EcoRI and KpnI ...
-
bioRxiv - Immunology 2023Quote: ... expressing the firefly coding sequence under control of a synthetic promoter containing SMAD-binding elements (SBEs) was obtained from AddGene (#45126). pEFBOS mCherry-mSTING expressing monomeric Cherry fused to the N-terminus of murine STING ...
-
bioRxiv - Neuroscience 2024Quote: ... we cloned CreERT2 (Cre recombinase fused to a mutant ligand-binding domain of the estrogen receptor) and IRES into the BamHI site of pAAV-EF1a-tdTomato-WPRE-pGHpA (Addgene #67527). To prevent leakage of Cre activity34 ...
-
bioRxiv - Bioengineering 2024Quote: ... a viral expression plasmid encoding mKate2 downstream of tandem NF-κB binding sites (37) (Addgene #105173, a gift from Timothy Lu) was co-transfected with gag/pol and env vectors ...
-
bioRxiv - Genomics 2020Quote: ... pCFJ104 - Pmyo-3∷mCherry∷unc-54 (Addgene plasmid # 19328 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 3 μg psPAX2 (packaging plasmid; Addgene) was performed using iN-fect (Intron Biotechnology ...
-
bioRxiv - Cell Biology 2021Quote: ... and pGH8 (Prab-3::mCherry, Addgene #19359) (Frøkjaer-Jensen et al. ...
-
bioRxiv - Genomics 2022Quote: ... and 3 μg pMD2.G (Addgene, #12259) into 293T cells cultured in 100 mm dish ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 μg of pGW-PervevalHR (Addgene #57432) (22) ...
-
bioRxiv - Immunology 2021Quote: ... myc (pCSF107mT-GATEWAY-3’-Myc tag, Addgene), green fluorescence protein (GFP ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 3 μg of pVSVg (8454; Addgene); FuGENE HD transfection reagent (Promega ...
-
bioRxiv - Genetics 2022Quote: ... Tc’hsp5’-Gal4Delta-3’UTR] (Addgene plasmid # 86449) was used as a donor plasmid with Piggybac insertion repeats and the 3xP3::EGFP reporter (Schinko et al. ...
-
bioRxiv - Physiology 2023Quote: ... and mPlum-mito-3 (Addgene plasmid #55988) using Fugene6 (Promega Inc. ...
-
bioRxiv - Neuroscience 2022Quote: ... +0.4 ML with diluted (1:3; Addgene) 4 × 0.15 μL of AAV9-Synapsin-jGCaMP7f-WPRE (Addgene) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... MAFA in pX330S-3 (Plasmid #58779, Addgene), Insulin in pX330S-4 (Plasmid #58780 ...
-
bioRxiv - Genomics 2023Quote: ... with 3 μg of psPAX (Addgene, 12260) and 1 μg of pMD2.G (Addgene ...
-
bioRxiv - Cell Biology 2023Quote: ... pT7-EGFP-C1-HsDCP1a was a gift from Elisa Izaurralde (Addgene plasmid # 25030; http://n2t.net/addgene:25030;RRID:Addgene_25030) (Tritschler et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... 25 ng/µl of co-injection marker pCFJ104 (Pmyo-3:mCherry:unc-54 3’UTR, a gift from Erik Jorgensen, Addgene plasmid #19328 ...
-
bioRxiv - Neuroscience 2022Quote: ... The cDNA of Ncam2.1 was amplified from the pCNcam2.1 with 5’-ACCATGAGCCTCCTCCTCTCC-3’ and 5’-CTGACCAAGGTGCTGAAACT-3’and cloned into pWPI (Plasmid #12254, Addgene) within PmeI site to obtain the pWPI-NCAM2.1 ...
-
bioRxiv - Neuroscience 2022Quote: ... The cDNA of Ncam2.2 was amplified with 5’-ACCATGAGCCTCCTCCTCTCC-3’ and 5’-TCTCTGATCAGGGAGTACCA-3’ and cloned into pWPI (Plasmid #12254, Addgene) within PmeI site to obtain the pWPI-NCAM2.2.
-
bioRxiv - Neuroscience 2022Quote: ... A pcDNA3 flag HA 14-3-3 β plasmid was a gift from William Sellers (Addgene plasmid # 8999; http://n2t.net/addgene:8999; RRID:Addgene_8999). All plasmids were verified by Sanger sequencing and/or long-read sequencing (Iowa IIHG Genomics core or Plasmidsaurus ...
-
bioRxiv - Systems Biology 2019Quote: ... A20-targeting guide RNAs (5’ – CACCGTTTGCTACGACACTCGGAAC – 3’, and 5’ – CACCGCTCGGAACTTTAAATTCCGC – 3’) were cloned into lentiCRISPR v2 (Addgene Plasmid #52961)48 and used for lentivirus production in HEK293T cells ...
-
bioRxiv - Genetics 2023Quote: ... GFP-3’UTR was PCR amplified using primers (5’-AGCTTGCATGCCTGCAGGTCG-3’ and 5’-AAGGGCCCGTACGGCCGACTA-3’) and plasmid pPD95.75 (Plasmid #1494-Addgene) as the template ...
-
bioRxiv - Molecular Biology 2024Quote: ... SK-BR-3 HER2-knockout (SK-BR-3 KO) were obtained using pSpCas9 BB-2A-Puro (PX459) V2.0 (9200 bp, Addgene) containing a sgRNA sequence (5’-TCATCGCTCACAACCAAGTG-3’ ...
-
bioRxiv - Developmental Biology 2022Quote: ... Samples were incubated with Protein A/G-MNase fusion protein (Addgene, Cat #123461) at 700 ng/mL for 1 hour at 4°C ...
-
bioRxiv - Neuroscience 2024Quote: ... polyA_R, Table 3) and plasmid backbone (Col1E_F, Col1E_R, Table 4) were amplified from pPRISM-Stop-cmlc2-eGFP (Addgene kit #1000000154; Wierson et al., 2020). The PCR-amplified fragments were assembled using NEBuilder HiFi DNA Assembly Cloning Kit (E5520S ...
-
bioRxiv - Molecular Biology 2024Quote: ... reporter cell lines were generated by TALEN-mediated homology-directed repair to integrate enhancer reporter donor constructs into the AAVS1 locus by electroporation of 1 × 106 K562 cells (or K562 cells selected to have the desired synthetic transcription factor) with 1 ng of reporter donor plasmid and 0.5 ng of each TALEN-L (Addgene no. 35431) and TALEN-R (Addgene no ...
-
bioRxiv - Biochemistry 2021Quote: ... or control peptides with the binding motifs mutated were fused to C terminus of EGFP and cloned to pLJM1-EGFP vector (David Sabatini lab, Addgene plasmid #19319).