Labshake search
Citations for Addgene :
1 - 50 of 1428 citations for Mouse Eukaryotic translation initiation factor 4E binding protein 3 EIF4EBP3 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... Ras GTPase-activating protein-binding protein 1 (G3BP1) phage UbiC G3BP1-GFP-GFP was a gift from Jeffrey Chao (Addgene plasmid # 119950 ...
-
bioRxiv - Cell Biology 2023Quote: ... Both GFP11-tagged Fluc proteins and GEM transcriptional factor (cloned from pJW1663, Addgene plasmid #112037) were stably integrated into yeast genome ...
-
bioRxiv - Cell Biology 2023Quote: ... conjugated with the Rhotekin Rho Binding domain (RBD)-GST fusion protein (produced from Addgene plasmid #15247), for 1 hour at 4 °C ...
-
bioRxiv - Biochemistry 2023Quote: Two vectors with C-terminal MBP (maltose-binding protein)-His6 Tag (2Cc-T; Addgene Plasmid #55209) or N-terminal His10-MBP Tag (2CT-10 ...
-
bioRxiv - Bioengineering 2023Quote: ... ssDNA binding protein and peptide sequences were synthesized and assembled into an AIO plasmid modified from Addgene plasmid #42230 by golden gate cloning ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The AND gate constructs were optimized by making constructs with ribosome binding site library (5’-GAAAGANNNGANNNACTA-3’) in front of regulators in chemically competent Marionette Clo cells prepared from Addgene [40] ...
-
bioRxiv - Biochemistry 2021Quote: ... by cloning our codon optimized Syx gene into vectors containing the following tags that are cleavable with tobacco etch virus (TEV) protease: N-terminal His6 plus maltose binding protein (MBP; RRID:Addgene_29708); C-terminal MBP plus His6 (Addgene_37237) ...
-
bioRxiv - Biochemistry 2022Quote: ... full-length FUS with an N-terminal histidine tag and maltose-binding protein fusion (pTHMT FUS 1-526, AddGene #98651), and FUS RGG3 with N-terminal histidine tag and MBP fusion (pTHMT FUS RGG3 (453-507) ...
-
bioRxiv - Biochemistry 2022Quote: ... All expression constructs were in the form containing an N-terminal His6 and maltose-binding protein (MBP) tag (Addgene #11517).
-
bioRxiv - Cell Biology 2023Quote: ... polyspora Hop1319-529 into UC Berkeley Macrolab vectors to generate N-terminal TEV protease-cleavable His6- or His6-maltose binding protein tags (Addgene #29666, 29706). DNA binding mutants of S ...
-
bioRxiv - Cell Biology 2020Quote: mCherry-ER fusion protein was amplified by PCR from mCherry-ER-3 plasmid (Addgene) and cloned into Gateway modified pBABE (in house) ...
-
bioRxiv - Neuroscience 2019Quote: ... with different fluorescent protein genes and helper plasmids (3 μg pcDNA-SADB19N (Addgene, 32630), 1.5 μg pcDNA-SADB19P (Addgene ...
-
bioRxiv - Neuroscience 2021Quote: ... targeting LRRK2 sequence near GTP binding and ATP kinase binding domains were synthesized and cloned into pSpCas9(BB)-2A-GFP plasmid (Addgene #48138). Plasmids were transfected into A18945 iPSC line using Lipofectamine-Stem transfection reagent (ThermoFisher #STEM00001 ...
-
bioRxiv - Bioengineering 2022Quote: ... The T-cell factor/lymphoid enhancer factor (TCF/LEF) luciferase reporter SuperTopFlash (STF) and the control pRL-SV40 Renilla luciferase constructs (Addgene) were used for Wnt/β-catenin-responsive reporter assays ...
-
Comprehensive fitness landscape of SARS-CoV-2 Mpro reveals insights into viral resistance mechanismsbioRxiv - Molecular Biology 2022Quote: ... The LexA_ER_B112 transcription factor was amplified from Addgene_58437 (FRP880_PACT1(−1-520)-LexA-ER-haB112-TCYC1 was a gift from Joerg Stelling ...
-
bioRxiv - Cancer Biology 2021Quote: ... or FOP flash (mutated TCF binding sites; Addgene#12457) luciferase expression vectors and with Renilla luciferase vector (control ...
-
bioRxiv - Cell Biology 2023Quote: ... or MRE plasmid with mutated TCF binding sites (Addgene, 12457), together with 100 ng of the Renilla luciferase control plasmid (Addgene ...
-
bioRxiv - Synthetic Biology 2021Quote: ... to specifically target TP53 translation stop site and it was cloned into pX330-U6-Chimeric_BB-CBh-hSpCas9-hGem (1/110) (Addgene #71707) according to the protocol of Ran et al.51 ...
-
bioRxiv - Cell Biology 2022Quote: ... targeting genomic region immediately upstream of the translation stop codon of Sox2 or Sox15 was cloned into LentiCRISPRv2 vector (Addgene). Single-stranded (ss ...
-
bioRxiv - Biochemistry 2021Quote: sgRNA targeting genomic region immediately downstream of the ATG translation start codon of ABCF1 was cloned into LentiCRISPRv2 vector (Addgene). A single-stranded (ss ...
-
bioRxiv - Neuroscience 2019Quote: ... was generated via Gibson Assembly based on pmyo-3::QuasAr::mOrange and pPD96.52 (pmyo-3, Fire Lab Vector Kit, Addgene plasmid #1608), using restriction enzymes BamHI and XbaI and primers QUASAR_fwd (5’-cccacgaccactagatccatATGGTAAGTATCGCTCTGCAG-3’ ...
-
bioRxiv - Molecular Biology 2020Quote: An sgRNA targeting the MDC1 gene around the ATG translation start site was cloned in pSpCas9 (BB)-2A-GFP plasmid (Addgene #48138). The plasmid was then transfected into HEK-293T cells along with a single stranded oligodeoxynucleotide (ssODN ...
-
bioRxiv - Molecular Biology 2021Quote: ... we generated guide RNAs targeting a site close to the putative translation start site and cloned into the pX330 vector using BbsI (Addgene 42230), as summarized in Table S3 ...
-
bioRxiv - Molecular Biology 2023Quote: An sgRNA targeting the ZFC3H1 gene around the ATG translation start site was cloned in pSpCas9 (BB)-2A-GFP plasmid (Addgene #48138). The plasmid was then transfected into HEK-293T cells along with a single stranded oligodeoxynucleotide (ssODN ...
-
bioRxiv - Developmental Biology 2019Quote: ... was a gift from Elisa Izaurralde (Addgene plasmid # 37370) (78) ...
-
bioRxiv - Bioengineering 2020Quote: ... The antigen-binding fragments (Fab) were cloned into pHLSec vector (Addgene, #99845) using AgeI and XhoI restriction sites ...
-
bioRxiv - Neuroscience 2023Quote: ... a Streptavidin-binding peptide-FLAG (SFB)-tagged USP7 construct56 (Addgene plasmid #99393) was transfected into HEK293T cells via PEI transfection ...
-
bioRxiv - Cancer Biology 2024Quote: ... the promoter of the established TEAD binding reporter (8xGTIIC)(18) (Addgene, 34615) was fused into a construct containing destabilized GFP (Addgene ...
-
bioRxiv - Cell Biology 2023Quote: ... JR20s were used to express Cas9 and sgRNA (5’-TCGACAGCCTTATGGCGGAC-3’) targeting mouse PFN1 25 from pLentiCRISPRv2 (Addgene #52961) by lentiviral transduction ...
-
bioRxiv - Cell Biology 2023Quote: ... fibroblasts were reprogrammed using lentiviral vectors that carried six transcription factors (ADDGENE/PSIN4-EF2-N2L ...
-
bioRxiv - Cell Biology 2020Quote: ... PG13-luc (WT p53 binding sites) was a gift from Bert Vogelstein (Addgene plasmid # 16442 ...
-
bioRxiv - Cancer Biology 2021Quote: Cells were transfected with either TOP flash (containing TCF binding sites; Addgene#12456) or FOP flash (mutated TCF binding sites ...
-
bioRxiv - Neuroscience 2022Quote: ... The gRNA binding sequence (AAGAGGTACGTACAGGTACT) was inserted into the vector pDD162 (from Addgene) using the NEB Q5 Site-Directed Mutagenesis Kit ...
-
bioRxiv - Neuroscience 2022Quote: ... we cloned the dgn-1 promoter and AcNPV p10 3’UTR into the vector pPD49.26 (from the Andrew Fire plasmid kit, Addgene Kit #1000000001) to generate plasmid pNTC2 ...
-
bioRxiv - Biochemistry 2021Quote: ... and pT7-EGFP-C1-HsDCP2 were gifts from Elisa Izaurralde (Addgene plasmid # 25030 ...
-
bioRxiv - Cell Biology 2023Quote: ... pT7-EGFP-C1-HsDCP1a was a gift from Elisa Izaurralde (Addgene plasmid # 25030 ...
-
bioRxiv - Molecular Biology 2020Quote: The gRNA sequence: 5’-TTAAAGAGTAACTACCAACT-3’ targeting the mouse Xpo7 gene was cloned into the PX459 plasmid (Addgene #62988, (23)) ...
-
bioRxiv - Neuroscience 2024Quote: The transcription factors and the reverse tetracycline transactivator (rtTA) were obtained from Addgene (Tet-O-Fuw-Ascl1 Addgene plasmid #27150 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... all TF binding site and mKate sequences were derived from SPECS plasmids (Addgene #127842). The NFAT response element was subcloned from the pSIRV-NFAT-eGFP plasmid68 (a gift from Peter Steinberger ...
-
bioRxiv - Genomics 2021Quote: ... Clover fused with PUF RNA-binding domain were previously described: pAC1447 (Clover_PUFc) (Addgene #73689). PUF9R-tethered iRFP670 and mRuby2 were created by a combination of PCR (from IDT gBlocks ...
-
bioRxiv - Molecular Biology 2022Quote: ... The reporter constructs contained 14 UAS sites for Gal4-DBD binding (source: Addgene 128010), an enhancer and a core promoter ...
-
bioRxiv - Genomics 2024Quote: Clover fused with PUF RNA-binding domain were previously described: pAC1447 (Clover_PUFc) (Addgene #73689). Cloning of dCas9 expression plasmid (lenti-dCas9-Blast ...
-
bioRxiv - Immunology 2020Quote: We using the 3*Flag sequence to replace the GFP protein in the pLenti CMV GFP Puro vector (Addgene, 658-5) for adding some Restriction Enzyme cutting site (XbaI-EcoRV-BstBI-BamHI ...
-
bioRxiv - Microbiology 2022Quote: GFP and myc-tagged 14-3-3ε were generated as follows: a G-block containing the full-length 14-3-3ε protein (IDT) was cloned into pEGFP-C1 (Addgene #2487) using XhoI and BamHI restriction sites ...
-
bioRxiv - Genomics 2023Quote: ... and flanking regions of respective ER localized proteins were inserted into a backbone containing a UCOE-EF-1α promoter and a 3′ WPRE element (Addgene #135448) (Jost et al. ...
-
bioRxiv - Cell Biology 2021Quote: A gRNA targeting the second exon of mouse Tubb6 gene (5’-CGACCAGGCCGGAGGCTACG-3’) was designed and cloned in lentiCRISPRv2 (Addgene, 52961). Empty and Tubb6 gRNA-containing lentiCRISPRv2 were used to produce lentiviruses ...
-
bioRxiv - Cell Biology 2021Quote: ... pcDNA3-HA-14-3-3 beta (14-3-3β) was a gift from Michael Yaffe (Addgene #13270). pclbw-opa1(isoform 1)-myc (myc-Opa1 ...
-
bioRxiv - Immunology 2020Quote: ... A plasmid library of sgRNAs targeting all protein coding genes in the mouse genome (Brie Knockout library, Addgene 73633) was packaged into lentivirus using HEK293T cells ...
-
bioRxiv - Cell Biology 2020Quote: ... PG13-luc (wt p53 binding sites) was a gift from Bert Vogelstein (Addgene plasmid # 16442). The DNA polymerase used was Phusion High Fidelity (cat# E0553S ...
-
bioRxiv - Molecular Biology 2021Quote: ... of 14-3-3 theta into pEBFP2-C1 (Addgene plasmid #54665). A CHIP plasmid78 was a gift from Leonard Petrucelli and the CHIP ORF was cloned into pCMV-C2-6myc ...