Labshake search
Citations for Addgene :
101 - 150 of 1084 citations for Mouse Bcl 2 Modifying Factor BMF ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... and (2) pEVOL-pBpF (Addgene #31190), which encodes a tRNA synthetase/tRNA pair for the in vivo incorporation p-benzoyl-l-phenylalanine (Bpa ...
-
Targeted Perturb-seq Reveals EGR1 and FOS as Key Regulators of the Transcriptional RAF-MAPK ResponsebioRxiv - Systems Biology 2024Quote: ... 2 μg pMD2.G (Addgene #12259), and 36 μL Turbofect (Thermo Fisher ...
-
bioRxiv - Cell Biology 2024Quote: ... and pX330S-2-PITCh (Addgene #63670) were combined with guide RNAs (gRNAs ...
-
bioRxiv - Biochemistry 2024Quote: ... and pX330S-2-PITCh (63670, Addgene), expressing Cas9 nuclease and two gRNAs (see below for sequences ...
-
bioRxiv - Genetics 2023Quote: ... 2 µg pMD2.G (Addgene, 12259), 9 µg lentiviral plasmid ...
-
bioRxiv - Developmental Biology 2021Quote: A mouse Cnr1 cDNA fragment (Addgene, #13391) was cloned into all-in-one tetracycline inducible plasmid (pAS4.1w.Ppuro-aON ...
-
bioRxiv - Cell Biology 2021Quote: ... and mCherry-Climp63(mouse) (Addgene plasmid #136293) were gifts from Gia Voeltz36 ...
-
bioRxiv - Neuroscience 2023Quote: ... and pCDNA3-mouse PKA-RIIalpha-mEGFP (Addgene plasmid # 45527 ...
-
bioRxiv - Developmental Biology 2022Quote: Sufu KO #2 was transfected with 2 μg of either 1436 pcDNA3 Flag HA (Addgene plasmid: 10792), a pcDNA Flag HA vector with the Sufu open reading frame cloned from pcDNA Su(fu ...
-
bioRxiv - Biochemistry 2020Quote: ... anti-mouse IgG AlexaFluor-488 (Life Technologies A11029-EA. The following plasmids were used: mouse PM20D1-flag (Addgene 84566). pENN.AAV.tMCK.PI.eGFP.WPRE.bGH (Addgene 105556) ...
-
bioRxiv - Neuroscience 2023Quote: ... 1:2 dilution) or AAV5-pCAG-FLEX-EGFP-WPRE (1.1 x 1013 gc/ml, Addgene; 1:2 dilution) was injected in VTA (from bregma ...
-
bioRxiv - Cell Biology 2020Quote: ... pPD118.33 (Pmyo-2∷GFP) (Addgene plasmid #1596) at 5 ng/μl and pBSKS (Stratagene ...
-
bioRxiv - Microbiology 2022Quote: ... pDONR223 SARS-CoV-2 NSP2 (Addgene, 141256) and expression clones with N-terminal fusion tags were produced simply by Gateway cloning (Gateway™ LR Clonase™ II Enzyme mix ...
-
bioRxiv - Microbiology 2022Quote: ... pDONR207 SARS-CoV-2 NSP1 (Addgene, 141255), pDONR223 SARS-CoV-2 NSP2 (Addgene ...
-
bioRxiv - Genomics 2020Quote: ... pCFJ90 - Pmyo-2∷mCherry∷unc-54utr (Addgene plasmid # 19327 ...
-
bioRxiv - Cancer Biology 2019Quote: ... or into lentiCRISPR ver.2 (Addgene, #52961) using the BsmBI (New England Biolabs ...
-
bioRxiv - Neuroscience 2020Quote: [2] GAL4d from pBPGAL4.1Uw (Addgene plasmid #26226)(Primers:ADdomain,forward,5’-caggcggccgccataTGCATGGATCCGCCAACTTC AACCAGAGTGG-3’ ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 B.1.1.7 (Addgene, #170451), SARS-CoV-2 B.1.351 (Addgene ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 P.1 (Addgene, #170450), SARS-CoV-1 (Addgene ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 B.1.351 (Addgene, #170449), SARS-CoV-2 P.1 (Addgene ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 B.1.167.2 (Addgene, #172320), SARS-CoV-2 B.1.1.7 (Addgene ...
-
bioRxiv - Immunology 2022Quote: ... 2 µg pMDLg/pRRE (Addgene plasmid #12251), 4.64 µg pRSV-Rev (Addgene plasmid #12253) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... NKX6.1 in pX330S-2 (Plasmid #58778; Addgene), MAFA in pX330S-3 (Plasmid #58779 ...
-
bioRxiv - Cell Biology 2023Quote: ... and pcDNA3.1-2xFLAG-SREBP-2 (#26807, Addgene). Amplified N-SREBP1a (Ad5-N-SREBP1a) ...
-
bioRxiv - Molecular Biology 2022Quote: ... For overexpressing ACE2 (Addgene, Appendix Table 2) in HPLFs ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and pBMTBX-2 (Addgene plasmid No. 26073) were gifts from Dr ...
-
bioRxiv - Microbiology 2023Quote: ... pDONR223 SARS-CoV-2 NSP6 (Addgene #141260), and pDONR223 SARS-CoV-2 spike (Addgene #149329 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 2 µg pMD2.G (#12259, Addgene) plasmids by using lipofectamine 2000 (Life Technologies) ...
-
bioRxiv - Microbiology 2023Quote: ... pDONR207 SARS-CoV-2 nsp3 (Addgene # 141257), pDONR223 SARS-CoV-2 NSP6 (Addgene #141260) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and psPAX2 (2 µg; Addgene, Cat# 12260) were co-transfected with lentiviral expression construct (3 µg ...
-
bioRxiv - Genomics 2023Quote: ... and pMDG.2 (envelope vector; Addgene #12259) with the TKOv3 lentiCRISPR plasmid library [59] ...
-
bioRxiv - Neuroscience 2023Quote: ... ipo13b sgRNA2 into pU6a:sgRNA#2 (Addgene #64246), and ipo13b sgRNA3 into pU6b:sgRNA#3 (Addgene #64247) ...
-
bioRxiv - Molecular Biology 2023Quote: ... together with psPAX-2 (Addgene plasmid #12260) and pMD2.G (Addgene plasmid #12259) ...
-
bioRxiv - Microbiology 2023Quote: ... pDONR223 SARS-CoV-2 spike (Addgene #149329), B.1.1.7 SARS-CoV-2 spike (Sino Biological ...
-
bioRxiv - Microbiology 2023Quote: ... we used pcDNA3-GFP-IMP2-2 (Addgene plasmid # 42175 ...
-
bioRxiv - Cell Biology 2023Quote: ... pHAGE-FKBP-GFP-OPTN (2-119) (RRID:Addgene_208867), pHAGE-mt-mKeima-P2A-FRB-Fis1 (RRID:Addgene_135295).
-
bioRxiv - Genetics 2024Quote: ... and β-arrestin 2-mYFP (Addgene #36917). FUZ-mCherry was generated by sub-cloning with XhoI/BamHI into mCherry2-N1 backbone vector (Addgene #54517) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The YTK kit (Addgene; Kit #1000000061) was used as a source for all relevant non-coding DNA sequences — including promoters and terminators ...
-
bioRxiv - Immunology 2022Quote: HEK293A cells stably expressing mouse NLRP3 (Addgene 75127), and ASC-GFP (Addgene 73957 ...
-
bioRxiv - Neuroscience 2021Quote: ... plus empty pEGFP and mouse neuroligin-1B (Addgene #15261 ...
-
bioRxiv - Cell Biology 2021Quote: ... The generation of mouse myc-Bnip3 (Addgene #100796) was described previously 48 ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse GeCKOv2 CRISPR knockout pooled library (Addgene #1000000053,18), pMD2.G and psPAX2 were transfected into Lenti-X 293T cells ...
-
bioRxiv - Immunology 2022Quote: ... The Vκ1-33/CBE replacement of Vκ3-2 was mediated by homologous recombination using a PGKneolox2DTA.2 (Addgene #13449) construct and two guide RNAs that target the mouse Vκ3-2 segment ...
-
bioRxiv - Immunology 2019Quote: ... 2×106 HEK293T cells stably expressing FLAG-tagged Hem1 were transiently transfected with 2 μg myc-Rictor plasmid (Addgene). Control HEK293T cells were transfected with myc-Rictor or 10 ng GFP-3xFLAG as described ...
-
bioRxiv - Genomics 2019Quote: The plasmid pCMV-myc-Atg7(2) expressing ATG7 isoform 2 was a gift from Toren Finkel (Addgene plasmid #24921).31 The plasmid pCMV-myc-Atg7(1 ...
-
bioRxiv - Genetics 2021Quote: ... or the catalytic domain (CD) of mouse Dnmt3a and the C-terminal part of mouse Dnmt3L (3a3L) (amplified from pET28-Dnmt3a3L-sc27 (Addgene #71827)) and cloned in PiggyBac plasmids under control of the TRE3G promoter ...
-
bioRxiv - Developmental Biology 2021Quote: The mouse Trim41 cDNA (ENSMUST00000047145) tagged with PA and 1D4 was inserted under the control of the mouse Clgn promoter (Addgene #173686) (Ikawa et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... two independent sgRNA against mouse Chk2 (GTATACATAGAGGATCACAG and GCTGGAGACAGTGTCTACCC) or mouse Trp53 (56) were cloned into pKLV-U6gRNA(BbsI)-PGKpuro2ABFP (Addgene, 50946). Lentiviral packaging plasmids (1µg pCMV-Rev ...
-
bioRxiv - Molecular Biology 2023Quote: Polymerase chain reaction (PCR) was used to isolate mouse AMPKγ1 cDNA from a mouse AMPKγ1-HA vector (#40605, Addgene, Watertown, MA, USA). Mouse AMPKγ1 cDNA was then cloned into the 3xFLAG-CMV10 vector (Sigma-Aldrich ...
-
bioRxiv - Synthetic Biology 2022Quote: ... MoClo Plant Parts Kit (Addgene Kit #1000000047), GreenGate Cloning System (Addgene Kit #1000000036 ...