Labshake search
Citations for Addgene :
1 - 50 of 1084 citations for Mouse Bcl 2 Modifying Factor BMF ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2019Quote: ... Bcl-2 proteins and their mutants (pMIG-Bcl-xL from Addgene, pMIG-BCL2 [6] ...
-
bioRxiv - Genomics 2021Quote: ... LentiGuide-mCherry was generated by modifying lentiGuide-puro (Addgene) to remove a puromycin-resistant gene and replace it with mCherry ...
-
bioRxiv - Developmental Biology 2022Quote: The three conditional lines for transcription factor overexpression (Rosa-A, GA, GAP) were constructed by modifying the Ai3 targeting construct (Addgene #22797; (Madisen, et al., 2010). The EGFP insert in Ai3 was removed by FseI digestion and replaced with coding regions for the following ...
-
bioRxiv - Immunology 2020Quote: ... The donor plasmid (pW290) used to target the endogenous mouse Wapl locus was constructed by modifying a published pMK290 plasmid (Plasmid #86230, Addgene). Briefly ...
-
bioRxiv - Cancer Biology 2023Quote: ... obtained by modifying the TtRMPVIR plasmid (Addgene, Cambridge, MA, USA, plasmid #27995). MycMUT (A59V ...
-
bioRxiv - Cancer Biology 2022Quote: Retroviral particles from pMIG Bcl-xL (Addgene #8790), and lentiviral particles from pLenti6.3/TO/V5 containing IDH1R132H,13 or pLentiCRISPRv2 (Addgene #52961 ...
-
bioRxiv - Microbiology 2021Quote: ... was generated by modifying pCW-Cas9-Blast (a gift from Mohan Babu, Addgene # 83481) to include a single BamHi site ...
-
bioRxiv - Neuroscience 2022Quote: ... The donor plasmids were constructed by modifying the AAVS1-CAG-hrGFP (Addgene plasmids #52344) and replacing the GFP with Cas9 (Addgene plasmids #42230) ...
-
bioRxiv - Genetics 2022Quote: The HACK donor vectors were constructed by modifying pHACK(Gal4)-DONR(T2A-Cas9) (Addgene # 194768), a donor vector for converting Gal4 into Cas9 (Koreman et al ...
-
bioRxiv - Genetics 2023Quote: ... generated by modifying pLenti-DsRed-IRES-EGFP (Addgene plasmid 92194, a gift from Huda Zoghbi), or control plasmids expressing either GFP or dsRed ...
-
bioRxiv - Developmental Biology 2023Quote: Lentiviral shRNA expression constructs were generated by first modifying the pLKO.1 puro vector (Addgene #8453), digesting with BamHI and KpnI and replacing the puromycin resistance cassette with an mCherry coding sequence.
-
bioRxiv - Cancer Biology 2020Quote: Bcl-xS and RBM10 were obtained from Addgene (Cambridge, MA). Plasmid transfections required 3 μg/well and were carried out using 0.1% Fugene HD (Promega).
-
bioRxiv - Genomics 2023Quote: ... the entry vector was constructed by adding a bcl-2 splice acceptor and four SV40 polyA-signals to a plasmid backbone based on pSMART (Addgene #49157) containing a green fluorescent protein (GFP ...
-
bioRxiv - Neuroscience 2020Quote: A Nectin-3 overexpression construct was created by modifying a pCag-iCre expression vector (Addgene plasmid # 89573). Nectin-3 alpha was PCR amplified (KOD hot start DNA polymerase ...
-
bioRxiv - Developmental Biology 2019Quote: ... pCIG-CA-mTOR was generated by modifying the pcDNA3-FLAG-mTOR-S2215Y vector purchased from Addgene (# 69013), which was deposited by Dr ...
-
bioRxiv - Microbiology 2022Quote: ... gRNAs targeting BCL2 or BCL-W were cloned in pLentiGuide (Addgene #117986) that was linearized with BsmBI (NEB) ...
-
bioRxiv - Biophysics 2021Quote: Monomeric and multimeric fluorescent controls were derived by modifying previously published plasmids designed to express CD86-EGFP (Addgene # 133858) and mApple-CD86-EGFP (Addgene #133860 ...
-
bioRxiv - Immunology 2020Quote: Self-inactivating retroviral vector pSIRG-NGFR was generated by modifying pSIR-dsRed-Express2(Fujita and Fujii, 2014) (Addgene #51135), which enables us to clone sgRNA as efficient as lentiCRISPRv2 ...
-
bioRxiv - Immunology 2020Quote: ... for introducing the doxycycline inducible OsTIR1-V5 expression cassette into endogenous Rosa26 locus was constructed by modifying a published pEN113 plasmid (Plasmid #86233, Addgene). The donor plasmid (pW290 ...
-
bioRxiv - Neuroscience 2020Quote: ... a TRIL-based miRNA construct was constructed by modifying the Cre-dependent AAV-FLEX-EGFP-mir30 (Scn9a) (Addgene plasmid # 79672) (43 ...
-
bioRxiv - Molecular Biology 2021Quote: The Rai1-HA-3x-FLAG-P2A-GFP cell line was generated by modifying a published method: a donor plasmid was constructed using the pFETCH Donor plasmid (Addgene plasmid #63934 from Eric Mendenhall and Richard M ...
-
bioRxiv - Genomics 2020Quote: We constructed a vector (sgOpti-HyPR) capable of expressing both a gRNA and a “detection barcode” by modifying sgOpti (Addgene 85681) to insert a 400 bp fragment between the puromycin resistance cassette and WPRE ...
-
bioRxiv - Genomics 2020Quote: ... plasmids containing sequences for dCas9 and CTCF were generated by modifying lenti-dCas-VP64-Blast (a gift from Feng Zhang, Addgene #61425). The VP64 cassette was replaced by CTCF sequences to generate dCas9-CTCF and neomycin resistant marker that was taken from pAC95-pmax-dCas9VP160-2A-neo (a gift from Rudolf Jaenisch ...
-
bioRxiv - Immunology 2021Quote: A lentiviral vector suitable for convenient subcloning between these modified pMY and pMX vectors was made by modifying lentiCRISPR v2 (Addgene: #52961) (Sanjana ...
-
bioRxiv - Neuroscience 2023Quote: The all-in-one gRNA-Cas9 expression plasmid used for CRISPRa was generated by modifying the hUBC-dSpCas9-2xVP64-T2A-BSD plasmid (Addgene #162333) to remove the T2A-BSD selection marker and include a U6-gRNA scaffold ...
-
bioRxiv - Cell Biology 2021Quote: ΦNX-ecotropic packaging cells were transfected with pBABE-hygro (Addgene plasmid # 1765; empty or Bcl-XL) using Lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Molecular Biology 2022Quote: A lentiviral plasmid for the stable expression of ultralong scFvs was generated by modifying LentiCRISPR v2 (Addgene plasmid #52961, a gift from Feng Zhang). An internal ribosomal entry site (IRES ...
-
bioRxiv - Genetics 2023Quote: ... and pX330S-2 (Addgene Kit 1000000055) according to the kit instructions ...
-
bioRxiv - Bioengineering 2022Quote: ... The T-cell factor/lymphoid enhancer factor (TCF/LEF) luciferase reporter SuperTopFlash (STF) and the control pRL-SV40 Renilla luciferase constructs (Addgene) were used for Wnt/β-catenin-responsive reporter assays ...
-
Comprehensive fitness landscape of SARS-CoV-2 Mpro reveals insights into viral resistance mechanismsbioRxiv - Molecular Biology 2022Quote: ... The LexA_ER_B112 transcription factor was amplified from Addgene_58437 (FRP880_PACT1(−1-520)-LexA-ER-haB112-TCYC1 was a gift from Joerg Stelling ...
-
bioRxiv - Developmental Biology 2019Quote: ... was a gift from Elisa Izaurralde (Addgene plasmid # 37370) (78) ...
-
bioRxiv - Cell Biology 2023Quote: ... fibroblasts were reprogrammed using lentiviral vectors that carried six transcription factors (ADDGENE/PSIN4-EF2-N2L ...
-
bioRxiv - Biochemistry 2021Quote: ... and pT7-EGFP-C1-HsDCP2 were gifts from Elisa Izaurralde (Addgene plasmid # 25030 ...
-
bioRxiv - Cell Biology 2023Quote: ... pT7-EGFP-C1-HsDCP1a was a gift from Elisa Izaurralde (Addgene plasmid # 25030 ...
-
bioRxiv - Neuroscience 2024Quote: The transcription factors and the reverse tetracycline transactivator (rtTA) were obtained from Addgene (Tet-O-Fuw-Ascl1 Addgene plasmid #27150 ...
-
bioRxiv - Molecular Biology 2021Quote: ... pAc5.1C-FLuc-Stop-5BoxB was a gift from Elisa Izaurralde (Addgene plasmid # 21301)30 ...
-
bioRxiv - Genomics 2020Quote: pNTI729 was constructed by first amplifying the ZEM transcription factor from pNTI638 (pHES795 Addgene #87943) (17 ...
-
bioRxiv - Neuroscience 2021Quote: ... and the Egr1 transcription factor (pcDNA3-Egr1, a gift from Eileen Adamson, Addgene plasmid #11729) known to stimulate the Cav3.2 promotor 25.
-
bioRxiv - Cell Biology 2023Quote: ... Both GFP11-tagged Fluc proteins and GEM transcriptional factor (cloned from pJW1663, Addgene plasmid #112037) were stably integrated into yeast genome ...
-
bioRxiv - Cancer Biology 2023Quote: ... sgRNAs targeting mouse and human genes of interest (see Supplementary Table 2) were cloned into plenti-sgRNA (Addgene plasmid #71409) using BsmbI and into Cas9 plasmid (Addgene plasmid #62988)(Ran et al ...
-
bioRxiv - Cell Biology 2023Quote: ... fibroblasts were reprogrammed using lentiviral vectors that carried six transcription factors (ADDGENE/PSIN4-EF2-N2L, ADDGENE/PSIN4-EF2-O2S and ADDGENE/PSIN4-CMV-K2M) ...
-
Upregulated GIRK2 counteracts ethanol-induced changes in excitability & respiration in human neuronsbioRxiv - Neuroscience 2024Quote: ... NPCs were induced into neurons with doxycycline-inducible transcription factor NGN2 with neomycin antibiotic selection (Addgene #99378), following the protocol described by (Ho et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... CRISPR guide RNA sequences (sgRNA#1 TTGTTGCCCAGGGTTTAACA and sgRNA#2 CCCATCCCCGGCACCGGGTC) targeting the mouse Nlk locus were cloned into pSpCas9n(BB)-2A-Puro (Addgene #62987; PX462). Cells were transfected with gRNA and Cas9n-expressing plasmids using Lipofectamine 2000 and successfully transfected cells were selected with 3μg ml-1 puromycin for two days ...
-
bioRxiv - Neuroscience 2021Quote: ... The BoxB reporter was pAc5.1C-Fluc-Stop-5BoxB (a gift from Elisa Izaurralde; Addgene plasmid #21301) (Behm-Ansmant et al. ...
-
bioRxiv - Cancer Biology 2023Quote: An XRN1 open-reading frame (ORF) clone deposited by Elisa Izaurralde was purchased from Addgene (#66596). The entire ORF was sequenced to confirm fidelity to the NCBI Reference Sequence NM_019001.5 ...
-
bioRxiv - Neuroscience 2020Quote: One adult mouse (~ 2 months) was stereotaxically injected with a GCaMP6f construct (AAV5.CamKII.GCaMP6f.WPRE.SV40 virus, Addgene # 100834; 0.4 μL at 0.06 μl/min) in hippocampal CA1 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... A human elongation factor 1 (EF1) promoter was introduced using a Gateway att4-att1 Entry clone (Addgene, Watertown, MA, #162920). Final expression clones were verified by restriction analysis and maxiprep DNA was prepared using the Qiaprep Maxiprep kit (Qiagen ...
-
bioRxiv - Neuroscience 2022Quote: ... the complementary DNA (cDNA) for each iMN factor (Ngn2, Lhx3, Isl1, NeuroD1, Ascl1, Brn2 and Myt1l) was purchased from Addgene and cloned into the pMXs retroviral expression vector using Gateway cloning technology (Invitrogen) ...
-
bioRxiv - Cell Biology 2023Quote: ... pT7-EGFP-C1-HsDCP1a was a gift from Elisa Izaurralde (Addgene plasmid # 25030; http://n2t.net/addgene:25030;RRID:Addgene_25030) (Tritschler et al. ...
-
bioRxiv - Genetics 2020Quote: A pair of TALENs targeting zebrafish tnfaip3 (A20) exon 2 were generated using “PLATINUM Gate TALEN Kit” (Addgene, #1000000043). 0.2 ng of mRNA encoding the TALEN pair was delivered into the cytoplasm of wild-type zebrafish embryos at the one-cell stage ...