Labshake search
Citations for Addgene :
101 - 150 of 10000+ citations for Human MMP24 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2023Quote: Plasmid mutagenesis was performed on pKS070 - pCAGGS-3XFLAG-(human) CTCF-eGFP (Addgene Plasmid #156448) for CTCF and mEmerald-RAD21-N-18 (Addgene Plasmid #54248 ...
-
bioRxiv - Cancer Biology 2019Quote: ... CTNNB1 shRNA constructs (Addgene # 18803) were provided by Dr ...
-
bioRxiv - Cell Biology 2021Quote: ... AAV-shRNA-ctrl (Addgene, #85741), and pcDNA6/V5-HisA plasmid was modified ...
-
bioRxiv - Developmental Biology 2019Quote: ... a scramble shRNA (Addgene-1864) targeting a random sequence 5’-CCTAAGGTTAAGTCGCCCTCGC-3’ was used ...
-
bioRxiv - Cancer Biology 2020Quote: ... shRNA-GFP control (Addgene, #30323).
-
bioRxiv - Cancer Biology 2023Quote: ... pLKO scrambled shRNA (Addgene (#1864)) was used as control.
-
bioRxiv - Biochemistry 2020Quote: ... Human ACE2 plasmid was obtained from Addgene (#1786, (6)) ...
-
bioRxiv - Microbiology 2021Quote: ... The recombinant plasmid containing human ACE2 gene (Addgene #1786) was transfected into HEK293T cells using Lipofectamine 2000 Transfection Reagent (Thermo Fisher ...
-
bioRxiv - Cancer Biology 2021Quote: Wild-type TP53 from both human (Addgene plasmid #69003) or zebrafish (3 days old embryos cDNA ...
-
bioRxiv - Cancer Biology 2021Quote: ... Human CD63 (Addgene plasmid #62964, gift from Paul Luzio) and mScarlet25 (Addgene plasmid #85042 ...
-
bioRxiv - Molecular Biology 2021Quote: ... human GFP-RBFOX2 (transcript variant 3) (Addgene, plasmid #63086) or empty vector (pcDNA 5 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Human STIM1-CFP plasmid (52) was from Addgene (#19755). CAV1-mEGFP plasmid (53 ...
-
bioRxiv - Cancer Biology 2023Quote: The lentiCRISPR v2 GeCKO Human library (Addgene plasmid #52961) was amplified following Sanjana et al. ...
-
bioRxiv - Cancer Biology 2023Quote: ... Human LATS1 expression plasmids were obtained from Addgene (41156). Human and murine NLRC5 and CXCL10 promoters were cloned into pGL3 basic luciferase reporter vector (Promega) ...
-
bioRxiv - Molecular Biology 2020Quote: ... NSUN6 knockdown mediated by shRNA was performed using pLKO.1-blast plasmid (modified from pLKO.1-puro, #10878, Addgene) with following shRNAs ...
-
bioRxiv - Cell Biology 2020Quote: ... pBrain-GFP-shTACC3 shRNA was a gift from Stephen Royle (Addgene plasmid # 59355; http://n2t.net/addgene:59355; RRID: Addgene_59355), pBrain-GFP-shGL2 was a gift from Stephen Royle (Addgene plasmid # 60004 ...
-
bioRxiv - Cancer Biology 2021Quote: ... each shRNA sequence was inserted into the Tet- pLKO-puro vector (a gift from Dmitri Wiederschain; Addgene plasmid #21915). The most efficient shRNA sequences we used were TRCN0000281204 for G6PDsh ...
-
bioRxiv - Cancer Biology 2023Quote: ... shRNA sequences were cloned into the 3rd generation transfer plasmid pLKO.1 TRC cloning vector (Addgene cat no. 10878) between unique AgeI and EcoRI sites downstream of the U6 promoter ...
-
bioRxiv - Molecular Biology 2020Quote: ... Smad3 overexpression plasmid was constructed by subcloning human Smad3 cDNA into pcDNA3.0 backbone plasmid (Addgene). GAS5 adenoviral vector was constructed by inserting mouse GAS5 cDNA into pShuttle-IRES-hrGFP-1 vector (Agilent) ...
-
bioRxiv - Neuroscience 2019Quote: ... The shRNA constructs to knockdown human DNMT3A1/3A2 and scrambled controls were hDNMT3A shRNA pSMP-DNMT3A1 and pSMP-Luc (a gift from George Daley, Addgene plasmid #36380 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Lentiviral control vector containing a scrambled shRNA (shSCR) was ordered from Addgene (scramble shRNA, Addgene # 1864).
-
bioRxiv - Genetics 2022Quote: ... Transfection mix for each shRNA contained 8.75μg of shRNA targeting construct in pLKO.1 (Addgene#8453), 8.75μg psPAX2 (Addgene#12260 ...
-
bioRxiv - Cell Biology 2021Quote: ... and pLKO.1 puro-based plasmid harboring the designed shRNA (pCMV-VSV-G and pLKO.1 puro were a gift from Bob Weinberg, Addgene plasmid #8454 ...
-
bioRxiv - Cell Biology 2022Quote: ... talin 2 shRNA-stable cells were co-transfected with Tln1 siRNA and EGFP-talin 1 head (Addgene plasmid no. 32856) or EGFP-talin 1 L325R (the mutant version ...
-
bioRxiv - Immunology 2020Quote: ... Generation of shRNA IFIT1 cells: 293T cells were co-transfected with psPax2 and pMD2.G (Addgene plasmids #12260 and #12259), as well as pLKO.1 (50 ...
-
bioRxiv - Immunology 2020Quote: ... UK) packaging construct in combination with pSuper.mBeta826 (DNA Polβ shRNA, a kind gift from Dr. Robert Sobol, [Addgene, Plasmid #12549]) (Trivedi et al. ...
-
bioRxiv - Neuroscience 2019Quote: ... The shRNA constructs to knockdown human DNMT3A1/3A2 and scrambled controls were hDNMT3A shRNA pSMP-DNMT3A1 and pSMP-Luc (a gift from George Daley, Addgene plasmid #36380, Addgene plasmid #36394 ...
-
bioRxiv - Genomics 2021Quote: ... a gift from Bob Weinberg. The cloning of the shRNAs in the pLKO.1 plasmid was performed as per the Addgene’s pLKO.1 cloning protocol ...
-
bioRxiv - Immunology 2022Quote: ... or the scrambled shRNA sequence: CCGGCA-ACAAGATGAAGAGCACCAATTTTT were transfected overnight into 293 LentiX packaging cells (Takoro) along with VSV-G plasmid envelope (Addgene), aiming to generate shLRBA and shControl encoding lentiviruses ...
-
bioRxiv - Genetics 2023Quote: ... ngRNA and shRNA plasmids were generated by ligating annealed and phosphorylated oligos into a BsmBI-digested lentiGuide-Puro (Addgene #52963) or an EcoRI-digested pLKO.1 backbone using T4 DNA ligase (Addgene #8453) ...
-
bioRxiv - Cell Biology 2023Quote: ... with the shRNA vector and Virapower packaging plasmids (pMDLg/pRRE, Addgene #12251; pRSV-Rev, Addgene #12253; pMD2.G, Addgene #12259) according to manufacturer instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... with the shRNA vector and Virapower packaging plasmids (pMDLg/pRRE, Addgene #12251; pRSV-Rev, Addgene #12253; pMD2.G, Addgene #12259) according to manufacturer instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... pLKO.1 Scrambled shRNA (#1864, Addgene), pLKO.1 HIF2α shRNA (#TRCN0000082307 ...
-
bioRxiv - Developmental Biology 2022Quote: ... A scramble shRNA (Addgene-1864, CCTAAGGTTAAGTCGCCCTCGC) was used as control ...
-
bioRxiv - Bioengineering 2021Quote: ... shRNA knockdown of p53 (#27077; Addgene); Sox2 ...
-
bioRxiv - Cancer Biology 2022Quote: ... shRNA sequences targeting NFS1 (Addgene, 102963), ISCU (Addgene ...
-
bioRxiv - Developmental Biology 2023Quote: ... and human rhinovirus 3C protease (HRV 3Cp; Addgene Plasmid #78571) were gifts from David Waugh (71–73) ...
-
bioRxiv - Immunology 2023Quote: ... and human IRF3-V5 (plasmid 32713) were purchased from AddGene. All DNA primers and synthesized genes were from IDT (Coralville ...
-
bioRxiv - Developmental Biology 2022Quote: ... A plasmid containing the full-length human FOS cDNA (NM_005252.4) was purchased from Addgene (Plasmid #59140). The full-length FOS cDNA was cloned into the pCS2 vector and FOS mRNA was generated using the mMessage mMachine Sp6 kit (Ambion ...
-
bioRxiv - Cancer Biology 2021Quote: shRNA vectors were created by annealing shRNA overlapping oligonucleotides and then cloned into pLKO.1 (Addgene, 10878). shRNA oligonucleotides sequences are detailed in Supplementary Table 1 ...
-
bioRxiv - Cancer Biology 2021Quote: ... The sequences of the control and ZEB1 shRNA were as follows: shRNA control (shCT) (Addgene sequence #1864):
-
bioRxiv - Cell Biology 2022Quote: All shRNA were generated by ligation of oligos into AgeI and EcoRI of pLKO.1 (Addgene plasmid #8453; Addgene, Teddington, UK). Lower case sequences represent the targeted sequences.
-
bioRxiv - Cell Biology 2022Quote: All shRNA were generated by ligation of oligos into AgeI and EcoRI of pLKO.1 (Addgene plasmid #8453; Addgene, Teddington, UK). Lower case sequences represent the targeted sequences.
-
bioRxiv - Cell Biology 2023Quote: ... NT#3-TTGGATGGGAAGTTCACCCCG) or IP3R1-targeting shRNA (ULTRA3316782- TTTCTTGATCACTTCCACCAG) were packaged as lentiviral particles using packaging (pCMV- dR8.2 dpvr, Addgene, plasmid #8455) and envelope vectors (pCMV-VSV-G ...
-
bioRxiv - Cancer Biology 2024Quote: ... ALKBH5 shRNA was generated by ligation of oligonucleotides into the AgeI and EcoRI restriction sites of pLKO.1 (Addgene plasmid #8453). Lentiviral-shRNA particles were generated by transfecting HEK 293T cells with 12 μg of pLJM1 vector containing the shRNA ...
-
bioRxiv - Biochemistry 2022Quote: A pET28a plasmid containing full-length human β-catenin was gifted from Randall Moon (Addgene plasmid # 17198) and various fragments of the coding region (residues 1-137 (NTERM) ...
-
bioRxiv - Molecular Biology 2019Quote: ... The donor plasmid pAAVS1-TRE3G-NGN2 was constructed by replacing EGFP with human NGN2 in plasmid AAVS1-TRE3G-EGFP (Addgene plasmid # 52343). The donor plasmid pAAVS1-TRE3G-NGN2 (5 μg) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The human TLR4 overexpression plasmid was purchased from Addgene (Cat. #13086). The T695A and T656A mutations were generated in WT-YME1L1 plasmid via QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent ...
-
bioRxiv - Cancer Biology 2020Quote: ... Plasmids encoding wild-type human RAB11 (#12679) was obtained from Addgene. The following primer sets were used for site directed mutagenesis:
-
bioRxiv - Cell Biology 2021Quote: ... The following plasmids were used: pEGFP-N1 human cofilin (Addgene 50859) and td-Tomato-LifeAct 7 (Addgene 54528).