Labshake search
Citations for Addgene :
101 - 150 of 1485 citations for Astrovirus Antigen Type 1 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: Full length wild type human DHX30 cDNA corresponding to transcript (ENST00000348968.8) was cloned into the TetON lentiviral vector pCW57.1 (Addgene), exploiting the Nhe I and Age I restriction endonucleases ...
-
bioRxiv - Synthetic Biology 2021Quote: ... mTiam1(64-437)-tgRFP-SspB wild type were a gift from Brian Kuhlman (Addgene plasmid # 60411; http://n2t.net/addgene:60411; RRID:Addgene_60411 ...
-
bioRxiv - Biochemistry 2022Quote: ... The wild-type 14-3-3 ζ gene was cloned into NcoI/XhoI digested pBAD plasmid (Addgene #85482) with a TEV cleavable C-terminal His6 purification tag ...
-
bioRxiv - Neuroscience 2023Quote: ... We used the following viral constructs and injection volumes per site in the different types of experiments: AAV.9.Syn.Flex.GCaMP6f.WPRE.SV40 (calcium recordings 140 nl; Addgene, no. 100833); AAV.1.hSyn.dio.EGFP (anterograde labelling ...
-
bioRxiv - Molecular Biology 2022Quote: ... Synthetic cell type specific promoters were obtained from the following Addgene plasmids: 161_pAAV-ProD5-CatCh-GFP-WPRE (Addgene plasmid # 125981 ...
-
bioRxiv - Cancer Biology 2022Quote: ... pCDNA3-V5-PTPN14-wild type was a gift from Jianmin Zhang (Addgene plasmid # 61003; http://n2t.net/addgene:61003 ; RRID:Addgene_61003). siRNAs (pool ...
-
bioRxiv - Microbiology 2023Quote: ... The parental strains Mtb Erdman wild-type and espA-tn were electroporated with the plasmid pKM461 (Addgene, #108320) expressing tetracycline-inducible Che9c phage RecT annealase and Bxb1 phage integrase (80) ...
-
bioRxiv - Microbiology 2023Quote: Sequences of all 16 plasmids used for the generation of wild type SA11 strain were obtained from Addgene (https://www.addgene.org/Takeshi_Kobayashi/)5 ...
-
bioRxiv - Cell Biology 2024Quote: Lentiviral-TOP/FOP-dGFP-reporters (wild-type consensus plasmid TOP: Addgene plasmid #14715; http://n2t.net/addgene:14715; RRID:Addgene_14715 ...
-
bioRxiv - Microbiology 2024Quote: ... Wild-type Myc-MEKK3 (in pcDNA3.1 vector) was generated from a kinase-dead mutant (K391A, Addgene plasmid # 44157)(55 ...
-
bioRxiv - Cell Biology 2020Quote: ... The plasmid containing the α1C subunit (CaV1.2) of L-type Ca2+ channels was a gift from Diane Lipscombe (Addgene plasmid # 26572 ...
-
bioRxiv - Biochemistry 2019Quote: ... a mammalian expression vector pRK5 encoding EGFP tagged wild-type (WT) human tau (pRK5-EGFP-tau, # 46904, RRID: Addgene_46904), which contains four C-terminal repeat regions and lacks the N-terminal sequences (0N4R) ...
-
bioRxiv - Microbiology 2021Quote: ... Plasmids for the expression of wild type spCas9 alone or in combination with gRNA were pcDNA3.3-hCas9 (Addgene #41815) and pX330-T2A-BFP (Addgene # 64216) ...
-
bioRxiv - Cancer Biology 2021Quote: ... pcDNA3-based plasmids encoding FLAG-tagged wild type and SATA (S939A/T1462A)-mutant TSC2(51) were obtained from Addgene. The TSC2-5A (S939A ...
-
bioRxiv - Neuroscience 2022Quote: ... The AU1-tagged wild-type and two mutant (S2215Y and R2505P) mTOR constructs were gifts from Fuyuhiko Tamanoi (Addgene) 59 ...
-
bioRxiv - Cancer Biology 2022Quote: Polyclonal SK-N-DZ cells constitutively expressing the CRISPR activation machinery were engineered by transducing wild-type cells with lentiviral particles carrying a dCas9-VP64 (lenti dCas9VP64_Blast, Addgene plasmid #61425 was a gift from Feng Zhang ...
-
bioRxiv - Cell Biology 2021Quote: ... GFP-hRab5B.dn3 (#1008) plasmid encoding GFP-labeled wild-type version of human Rab5B isoform was from Addgene (Cat# 61802). GFP-hRab5B(S34N ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Venus-iLID-CAAX (from KRas4B) and pLL7.0: mTiam1(64-437)-tgRFP-SspB wild type were a gift from Brian Kuhlman (Addgene plasmid # 60411 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... a plasmid containing cloned wild type AlkB protein (pET24a-AlkB deltaN11 [plasmid #73622]) was obtained from Addgene (http://www.addgene.org/), and the AlkB protein was expressed and purified at the CSU Biochemistry and Molecular Biology Protein Expression and Purification Facility.
-
bioRxiv - Neuroscience 2022Quote: ... N2a cells were co-transfected with the wild-type or FeRIC channels and GCaMP6 (GCaMP6 medium, Addgene cat.40754) or YFP-H148Q ...
-
bioRxiv - Neuroscience 2023Quote: Wild-type and Flailer primary neuronal cultures were infected at 3 DIV with AAV coding for GCaMP6s (Addgene #51086) and FL1 or control AAVs ...
-
bioRxiv - Neuroscience 2023Quote: Wild type Drosophila and human spectrins were cloned into a histidine tagged vector (2BC-T cloning vector, Addgene # 31070) using ligation independent cloning to obtain C-terminally tagged proteins ...
-
bioRxiv - Molecular Biology 2023Quote: ... The wild-type sequence of NPM1 was cloned from GFP-NPM WT (gift from Xin Wang, Addgene plasmid # 17578). Mutant NPM1 plasmids were constructed by ordering mutated regions as gBlocks from IDT with overhangs complementary to proximal regions ...
-
bioRxiv - Cell Biology 2023Quote: ... and subcloned into a pGEX-4T1 vector with an N-terminal MBP-tag followed by a TEV cleavage site before wild-type NAP1 (RRID:Addgene_208871), NAP1 delta-NDP52 (S37K/A44E ...
-
bioRxiv - Cell Biology 2024Quote: ... enables GFP and APEX to be targeted to cilia in many cell types via the N-terminal 203 residues of NPHP3 and was a gift from Maxence Nachury (RRID:Addgene_73186) (Mick et al ...
-
bioRxiv - Neuroscience 2022Quote: The pCMV-hEAAT2 plasmid encoding the human excitatory amino acid transporter type 2 (EAAT2) was a gift from Susan Amara (Addgene plasmid # 32814 ...
-
bioRxiv - Developmental Biology 2020Quote: ... To generate CRISPR Cas9 knockout mESC lines we transfected wild-type (for Srpk1 and Srpk2) or Rlim-/y (for Zfp42) mESCs with pX335 and pKN7 vectors (Addgene) containing gRNA sequences targeting ...
-
bioRxiv - Biochemistry 2020Quote: Recombinant wild-type Streptococcus pyogenes Cas9 REC3 domain (506-712) possessing an amino-terminal His10-MBP tag (Addgene, no. 101205) followed by a TEV protease site was expressed in Escherichia coli strain BL21(DE3 ...
-
bioRxiv - Neuroscience 2022Quote: ... This construct was generated from a plasmid that contained a wild-type (WT) rat Nfasc gene expressed from the cytomegalovirus (CMV) promoter (a gift from Vann Bennett, Addgene plasmid # 31061 ...
-
bioRxiv - Cell Biology 2021Quote: ... and GFP-hRab31.dn3 (#1019) plasmids encoding GFP-labeled versions of the indicated human wild-type proteins were from Addgene (Cat# 49549 ...
-
bioRxiv - Molecular Biology 2021Quote: ... HEK293Ts were made to stably express doxycycline(dox)-inducible wild-type muSOX and its catalytically-dead D219A mutant by PCR amplifying the aforementioned coding sequences from Addgene plasmids 131702 and 131704 using the muSOX F/R primers (see Key Resources Table ...
-
bioRxiv - Biophysics 2021Quote: The wild type SARS-CoV-2 S HexaPro expression plasmid was a gift from Jason McLellan (7) and obtained from Addgene (plasmid #154754 ...
-
bioRxiv - Developmental Biology 2022Quote: ... HDR donor plasmids carrying wild type me31B gene were constructed by cloning me31B gene DNA into pHD-sfGFP-ScarlessDsRed cloning vector (Addgene) according to suggested protocols ...
-
bioRxiv - Biophysics 2022Quote: The C-terminal 109 residues from wild-type TnsB (termed hereafter as TnsBCTD) was cloned from pXT129_TwinStrep-SUMO-ShTnsB vector (Addgene, #135525) using Q5 site-directed mutagenesis kit (NEB ...
-
bioRxiv - Immunology 2023Quote: DNA inserts containing the coding DNA sequence (CDS) for each wild type gene were generated by restriction digestion previous amplification from plasmids obtained from Addgene (hMX1 ...
-
bioRxiv - Cancer Biology 2023Quote: Human AKT1_D274A was generated by overlapping PCR mutagenesis using wild-type AKT1 (a gift from Thomas Leonard, Addgene plasmid 8656133) and cloned into a pAceBac1 vector with N-terminal His10-StrepII-(tev ...
-
bioRxiv - Neuroscience 2024Quote: Time-pregnant wild-type C57BL/6J female mice underwent in utero virus injection of CamkII-cre virus (105558-AAV1, Addgene) into the left side of the lateral ventricles ...
-
bioRxiv - Biochemistry 2020Quote: HEK293T CRISPR-Cas9 cells were generated by transfecting wild-type 293T cells with pX330-U6-Chimeric_BB-CBh-hSpCas9 vector (Addgene, Plasmid# 42230) carrying single-guide RNA (sgRNA ...
-
bioRxiv - Neuroscience 2021Quote: ... HEK293 cells were co-transfected with plasmids encoding wide-type myc-human TREM2 and GFP-human TDP-43 (residues 216-414, Addgene, 28197) or GFP control by the calcium phosphate precipitation method ...
-
bioRxiv - Cancer Biology 2022Quote: MIA PaCa-2 wild type (WT) and TSC1/TSC2 knockout (KO) cells were transduced with retrovirus expressing RFP (pQCXIP-turboRFP, Addgene #73016) or EGFP (pQCXIP-EGFP-F ...
-
bioRxiv - Molecular Biology 2023Quote: Plasmids for type I-F CASTs Cascade over-expression were constructed by sub-cloning the individual genes into pRSFDuet1 (Addgene #126878) to create pIF1008 ...
-
bioRxiv - Microbiology 2023Quote: HPV16 PsVs were produced by co-transfecting 293TT cells with wild-type p16SheLL-3XFLAG tag [14] together with pCAG-HcRed (Addgene #11152) or pCINeo-GFP [obtained from C ...
-
bioRxiv - Cell Biology 2020Quote: For the generation of stable A549 cell lines expressing various PKCs and mutants we used following plasmids: pcDNA3-PKCε-Flag (wild-type, Addgene, Cambridge, MA), pcDNA3-Flag-K312PKCε ...
-
bioRxiv - Immunology 2019Quote: ... We used the resulting virus particles to transduce immortalized wild-type C57BL/6 cells that express doxycycline-inducible SpCas9 enzyme (generated using Addgene plasmid #50661). We cultured transduced cells in 3.0 μg/ml blasticidin (Invivogen ...
-
bioRxiv - Cancer Biology 2019Quote: ... the wild-type and Δ365-371 mutant CELF1 were cloned in the pET His10 TEV LIC cloning vector (2B-T-10) (Addgene, Cambridge, MA) using NEBuilder HiFi DNA Assembly Master Mix (NEB ...
-
bioRxiv - Cell Biology 2021Quote: The Tau/pET29b plasmid used for wild type FLTau (2N4R) expression and purification was a gift from Peter Klein (Addgene plasmid #1631683).
-
bioRxiv - Cell Biology 2019Quote: ... Lztfl1-/- cells (Figure S2) were obtained by genome editing of immortalized wild type MEFs using guide (gMS04: GCTCGATCAAGAAAACCAAC) cloned into pLentiCrisprV2 (Addgene plasmid # 52961) (Sanjana et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... pDsRed-RAB11A WT (for expression of a fluorescently-tagged, wild-type version of RAB11A in human cells) was obtained from Addgene (plasmid 12679). For expression of GFP-HEATR5B from baculovirus ...
-
bioRxiv - Cell Biology 2020Quote: ... Venus-iLID-CAAX (from KRas4B) and pLL7.0: tgRFPt-SSPB wild-type (WT) (19) were gifts from Brian Kuhlman (Addgene plasmid #60411 and #60415). PR_GEF (2XPDZ-mCherry-Larg (DH) ...
-
bioRxiv - Bioengineering 2022Quote: Assembloids were formed with VTA- and PFC-like spheroids such that one spheroid type was transduced with AAV9-GCaMP6f (Addgene, cat# 100836-AAV9) while the other was transduced with either an inhibitory or excitatory DREADDs virus (Addgene ...