Labshake search
Citations for Addgene :
101 - 150 of 2085 citations for 6 aminonaphthalene 1 3 disulphonic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2022Quote: ... and 6 μg of psPAX2 (Addgene, Cat #12260) into a 10 cm plate of HEK293T cells at 60-70% using Fugene 6 transfection reagent (Promega ...
-
bioRxiv - Molecular Biology 2020Quote: ... the sequence encoding the native signal peptide and ECD of GPR56 (amino acids 1-400) was subcloned from pCAG-hGPR56-IRES-GFP (from Christopher A Walsh, Addgene 52297) into pCEP4 (Invitrogen ...
-
Targeted attenuation of elevated histone marks at SNCA alleviates α-synuclein in Parkinson’s diseasebioRxiv - Neuroscience 2020Quote: ... The catalytically active domains of JARID1A enzyme (1-797 amino acids) was amplified from pcDNA3/HA-FLAG-RBP2 plasmid (Addgene #14800), a gift from William Kaelin (Klose et al ...
-
bioRxiv - Physiology 2022Quote: ... or scramble short hairpin RNA (shRNA) (Table 3) was inserted into the plasmid pLKO.1 (8453; Addgene). pSF-lenti or pLKO.1 together with the two helper plasmids psPAX2 (Addgene plasmid 12260 ...
-
bioRxiv - Microbiology 2021Quote: ... 4-363h21C1 and 3-978h1C1 and were cloned into lentiviral vector pLKO.1-puro (Addgene, catalogue #8543). Lentiviral vectors were produced in 293T cells by Fugene transfection and the supernatant was used to infect Jurkat cells ...
-
bioRxiv - Cell Biology 2020Quote: ... 5′-CAAACAATCAGCAATGCCTG-3′ and 5′-TGAAGTATTCAGAACAGAAG-3′ and cloned into pX330-P2A-EGFP (Addgene) through ligation using T4 ligase (New England Biolabs) ...
-
bioRxiv - Cell Biology 2020Quote: ... and pET28a(+) (Addgene #69864-3), for His6-tag protein purification ...
-
bioRxiv - Systems Biology 2023Quote: ... and pMW#3 (Addgene #13350) destination vectors using LR Clonase (ThermoFisher) ...
-
bioRxiv - Molecular Biology 2023Quote: - vector pGEX-4T-3 (Addgene_79149) to express only GST protein for alternative screening.
-
bioRxiv - Systems Biology 2024Quote: ... and pMW#3 (Addgene #13350) destination vectors using LR Clonase (ThermoFisher #11791100) ...
-
bioRxiv - Immunology 2021Quote: ... HEK293T cells were seeded in 6-well plates and the next day transfected with 1 μg psPAX2 packaging plasmid (Addgene 12260), 500 ng pMD2.G VSV-G envelope plasmid (Addgene 12259 ...
-
bioRxiv - Biochemistry 2024Quote: The plasmid encoding amino acids 1-393 of the p53 protein with a FLAG tag at the C-terminus (Addgene plasmid #10838) was used as a template for site-directed mutagenesis to delete the N-terminal regions spanning amino acids 1-31 ...
-
bioRxiv - Biochemistry 2020Quote: ... Human ACE2 plasmid was obtained from Addgene (#1786, (6)) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 6 μg of psPAX2 packaging plasmid (Addgene plasmid #12260), and 2 μg pMD2.G envelope plasmid (Addgene plasmid #12259) ...
-
Linear ubiquitination at damaged lysosomes induces local NF-κB activation and controls cell survivalbioRxiv - Cell Biology 2023Quote: ... GFP as non-human target (NHT) control (5’-GGAGCGCACCATCTTCTTCA-3’, 5’-GCCACAAGTTCAGCGTGTC-3’, and 5’-GGGCGAGGAGCTGTTCACCG-3’) cloned into pLentiCRISPRv2 (Addgene, 52961, deposited by Feng Zhang). To generate lentiviral particles ...
-
bioRxiv - Neuroscience 2019Quote: A 60 nl viral mix containing a 3:1 ratio of AAV2retro-Cre (AAVrg-pmSyn1-EBFP-cre, Addgene) and AAV2-GFP (UNC viral core ...
-
bioRxiv - Cell Biology 2020Quote: ... was generated by ligating oligonucleotides containing the targeting sequence 5’-CAGTTCCTGGGTGGAGCTA-3’ into pLKO.1-puro (Addgene # 8453). The mitochondrial (CMV-mitoCAR-GECO1 ...
-
bioRxiv - Neuroscience 2023Quote: ... For transfection, 5 µg of DNA (4:3:1 of a transgene, pCMVdR8.74 (packaging plasmid; Addgene, Plasmid #22036) and pMD2.G (envelope plasmid ...
-
bioRxiv - Neuroscience 2023Quote: ... Suppl Fig 3: AAV9-CaMKIIa-hChR2-EYFP (1:5, Addgene viral prep #26969- AAV9; http://n2t.net.addgene:26969; RRID; Addgene:26969 ...
-
bioRxiv - Molecular Biology 2024Quote: ... CASFx-1 (RBFOX1N-dCasRx-C) and CASFx-3 (dCasRx-RBM38) were obtained from Addgene (Plasmid #118635 and #118638). RBFOX1N-dPspCas13b-C was constructed previously 13 ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... of a virus driving expression of membrane-targeted mCherry under control of the GFAP promoter (AAV5/GFAP-hM3dq-mCherry, University of Zurich, Figs. 1-5 or AAV5/GfaABC1D-Lck-GFP, Addgene, Fig. 6) in the NAcore (+1.5mm AP ...
-
bioRxiv - Biochemistry 2023Quote: ... MEFs were split into 6 well plates to ∼80% confluence and transfected with 2 µg SV40 1: pBSSVD2005 (a gift from David Ron; Addgene plasmid #21826) using FuGENE HD according to manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... A pcDNA3 flag HA 14-3-3 β plasmid was a gift from William Sellers (Addgene plasmid # 8999 ...
-
bioRxiv - Cell Biology 2023Quote: ... and let-858 3’ UTR and mKate::HA::let-858 3’UTR from pDD287 (Addgene #70685). Correct sequences of constructed plasmids were confirmed with Sanger sequencing ...
-
bioRxiv - Cell Biology 2019Quote: ... HA-14-3-3σ (11946, Addgene) was transfected into skin keratinocytes in primary culture using the P1 Primary Cell 4D-Nucleofector™ X Kit (V4XP-1024 ...
-
bioRxiv - Bioengineering 2022Quote: ... 3 μg pMD2.G (Addgene #12259), 12 μg pCMV delta R8.2 (Addgene #12263) ...
-
bioRxiv - Cell Biology 2021Quote: ... mEmerald-ER-3 (Addgene plasmid #54082), and calnexin-mEmerlad (Addgene plasmid #54021 ...
-
bioRxiv - Cell Biology 2021Quote: ... and 3 μg pMD2.G (Addgene) were transfected into 293T cells at 80% confluency in a 10-cm dish with 8 ml of media ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 μg psPax vector (Addgene #12260), 1.5 μg pMD2.G vector (Addgene #12259 ...
-
bioRxiv - Cell Biology 2021Quote: ... or Galectin-3-GFP (Addgene; [48]). The bacterial expression vector pZsGreen (Takara Bio USA ...
-
bioRxiv - Cell Biology 2021Quote: ... pCFJ104 (Pmyo-3::mCherry, Addgene #19328) and pGH8 (Prab-3::mCherry ...
-
bioRxiv - Bioengineering 2021Quote: ... 3 µg pMD2.G (Addgene #12259) and 9 µg lentiviral vector were diluted in 1.2 mL OptiMEM ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 3 μg psPAX2 (Addgene #12260) using Lipofectamine 3000 (Life Technologies ...
-
bioRxiv - Cell Biology 2024Quote: ... and 3 μg psPAX2 (AddGene 12260) using Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Biochemistry 2023Quote: ... mCherry-ER-3 (Addgene, Watertown, MA), or Perilipin1-YFP[41] following established protocols[32] ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3 µg of psPAX2 (Addgene #12260), and 1.5 µg of the pMD2.G plasmid (Addgene #12259 ...
-
bioRxiv - Neuroscience 2020Quote: ... bilaterally injected using a pulled glass needle in the hippocampal area with 0.5 μL AAV-hSyn-Cre-EGFP at 3 × 1012 GC ml-1 (Addgene #105540 ...
-
bioRxiv - Bioengineering 2021Quote: ... rat TE-NSPs were incubated overnight at 5 DIV with media including 1/2000 of pAAV1.hSyn.eGFP.WPRE.bHG (final titer of ~3×1010 genomic copies/mL; Addgene, 105539-AAV1), with a full media change on the next day.
-
bioRxiv - Neuroscience 2021Quote: ... a 1:3 mixture of AAV1-CAG-mRuby3 (custom made from plasmid Addgene 107744, titer: 1.6×1012 vg/ml) and AAV1-Syn (or CAG)-FLEX-GCaMP6s (Addgene ...
-
bioRxiv - Cell Biology 2021Quote: To generate the nrfl-1(null) deletion allele a mix containing Peft-3::Cas9 (Addgene #46168; 50 ng/μl), two pairs of sgRNA plasmids targeting the 5’ or 3’ ends of the nrfl-1 open reading frame (75 ng/μl each) ...
-
bioRxiv - Immunology 2021Quote: ... HIV-1 dual reporter vector expressing mCherry and luciferase (NL4-3 mCherry Luciferase, plasmid#44965) was purchased from Addgene. Plasmid expression a C-terminally truncated SARS-CoV-2 S protein (pSARS-CoV-2Δ19 ...
-
bioRxiv - Genomics 2022Quote: pNLZ10 (Pfib-1::NLS::dCas9::24xGCN4::NLS::tbb-2 3’UTR) construct contains pCFJ150 vector backbone (Addgene plasmid # 19329). SV40 NLS::dCas9::egl-13 NLS: ...
-
bioRxiv - Genomics 2023Quote: ... Both gRNA (1 µg each) vectors were co-transfected with 3 µg of pCas9_GFP (a gift from Kiran Musunuru; Addgene plasmid #44719 ...
-
bioRxiv - Cancer Biology 2024Quote: ... GGTGAGGTGGAAATGAGCCA; HK1-3: GGAGGGCAGCATCTTAACCA) and HK2 (HK2-1: GATGCGCCACATCGACATGG; HK2-2: TAAGCGGTTCCGCAAGGAGA) was cloned into lentiCRISPR v2 construct (RRID:Addgene_52961) using a protocol available online (Zhang_lab_LentiCRISPR_library_protocol.pdf) ...
-
bioRxiv - Developmental Biology 2022Quote: ... and then were inserted into pBP-Gal80Uw-6 (#26236, Addgene) via an L-R reaction with GATEWAY LR clonase II plus enzyme mix (12538120 ...
-
bioRxiv - Developmental Biology 2023Quote: ... EGFP-Tubulin-6 was a gift from Michael Davidson (Addgene plasmid # 56450 ...
-
bioRxiv - Cell Biology 2022Quote: ... and pLKO.6 sfCherry were generated from pLKO.1 puro plasmid (Addgene plasmid # 8453; http://n2t.net/addgene:8453; RRID:Addgene_8453; a gift from Bob Weinberg) (Stewart et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... and ectodomain (52-750 amino acids) of the NEP (#7283, Addgene) were used for the fusion protein and then inserted in rAAA-FLEX-axonGCaMP6s-P2A-mRUBY3 vector (#112008 ...
-
bioRxiv - Cancer Biology 2021Quote: ... HT-1080N cells were transduced with lentiviruses carrying the reverse tetracycline-controlled transactivator 3 under a CMV promoter (CMV-rtTA3) (Cat# w756-1, Addgene). HT-1080N-rtTA3 cell lines were selected in 10 μg/mL blasticidin (Cat # A1113902 ...
-
bioRxiv - Genomics 2022Quote: pNLZ11 (Pfib-1::NLS::scFv::sfGFP::NLS::tbb-2 3′UTR) construct has the pCFJ210 vector backbone (Addgene plasmid # 19329). A codon-optimized scFv::sfGFP fragment [42] was ordered from IDT ...