Labshake search
Citations for Addgene :
351 - 400 of 2085 citations for 6 aminonaphthalene 1 3 disulphonic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... Viral transductions were done on day 6 with 5 μL of AAV1-CaMKII-GLuc-ASARTDL (Addgene 149503) or AAV1-CaMKII-GLuc-Untagged (Addgene 149502 ...
-
bioRxiv - Neuroscience 2020Quote: ... This product was subcloned into pBPLexa:P65UW (Addgene plasmid # 26231, 63 or pBPGal80uw-6 (Addgene plasmid # 26236, 63), which were gifts from Gerry Rubin ...
-
bioRxiv - Neuroscience 2020Quote: ... In one C57BL/6 animal each we used AAV5-Syn-GCaMP6s or AAVrg-Syn-jGCaMP7f (Addgene, USA) with similar results to those obtained with GCaMP6f (Supplementary Fig ...
-
bioRxiv - Cancer Biology 2023Quote: ... RB1 and TP53 sgRNA sequences highlighted in Supplementary Table 6 were cloned in a LentiCRISPRv2 (Addgene # 52961) backbone (47) ...
-
bioRxiv - Microbiology 2024Quote: ... Guide RNAs targeting exon 6 of Akr1c13 were cloned into pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene #42230). A T7-sgRNA PCR product was amplified and in vitro transcribed as previously described (65 ...
-
bioRxiv - Biophysics 2021Quote: ... we used the retinoic acid-responsive firefly luciferase expression vector pGL3-RARE-luciferase (Addgene plasmid #13458; http://n2t.net/ad-dgene:13458; RRID:Addgene_13458), a gift from T ...
-
bioRxiv - Physiology 2019Quote: HepG2 cells were transfected with the luciferase expression construct under the Fatty Acid Synthetase (FAS) Promoter (Addgene# 8890) along with β-Gal plasmid (Ambion Cat ...
-
bioRxiv - Microbiology 2022Quote: ... pLenti-X2-Zeo-DEST (749-3) [a gift from Eric Campeau (Addgene, 21562)] and the donor vector ...
-
bioRxiv - Cell Biology 2019Quote: ... pCIG3 (pCMV-IRES-GFP version 3) was a gift from Felicia Goodrum (Addgene plasmid # 78264 ...
-
bioRxiv - Cancer Biology 2020Quote: ... sgFLI_Ex9 (5’-GCCTCACGGCGTGCAGGAAG-3’) was cloned into lentiCRISPR v2-Blast vector (Addgene, #83480) using BsmbI restriction sites ...
-
bioRxiv - Cell Biology 2020Quote: ... pDD162 (Peft-3::Cas9 + Empty sgRNA) was a gift from Bob Goldstein (Addgene plasmid # 47549 ...
-
bioRxiv - Biophysics 2020Quote: ... and a guide RNA/Cas9 plasmid pX330 human 3’ HP1α gRNA (Addgene 127907) with Lipofectamine 2000 according to manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... a p21 sgRNA (5’-GATTGCGATGCGCTCATGGC-3’) was cloned into the px330 vector (Addgene). ESCs were co-transfected with 2μg of this vector and 0,12μg of an hygromycin marker (#631625 ...
-
bioRxiv - Biochemistry 2021Quote: ... The pcDNA 3-CDK9 HA plasmid was purchased from Addgene (ID 14640, RRID:Addgene_14640), which was originally established by Dr Matija Peterlin (43) ...
-
bioRxiv - Neuroscience 2022Quote: ... unique sgRNA (5’-CACCGGGACATAGTATTTGAAAGAC-3’) was cloned into lenti-CRISPRv2 construct (Addgene #52961), which expresses Cas9 and puromycin cassette ...
-
bioRxiv - Neuroscience 2022Quote: A viral cocktail containing AAV2/5.GfaABC1D GCaMP6f (3 × 1012 gc/ml, Addgene) for astrocyte Ca2+ detection or AAV9.hSyn.GCaMP6f (3 × 1012 gc/ml ...
-
bioRxiv - Cell Biology 2020Quote: ... pDD162 (Peft-3::Cas9 + Empty sgRNA) was a gift from Bob Goldstein (Addgene plasmid # 47549 ...
-
bioRxiv - Cell Biology 2021Quote: ... the Cas9-expression plasmid pDD162 (Peft-3::Cas9, 50 ng/μL, Addgene #47549) (Dickinson et al. ...
-
bioRxiv - Immunology 2021Quote: ... pLenti-GFP (Core with 5’ and 3’ LTR) was also from Addgene (#17448) and the plasmids containing Tat1b and Rev1b (SARS-Related Coronavirus 2 ...
-
bioRxiv - Genetics 2019Quote: ... pDD162 (Peft-3∷Cas9 + Empty sgRNA) 49 was purchased from Addgene (Plasmid #47549). A repair oligo containing mutated PAM and new bases inserted between the sgRNA sequence and PAM (5’-CATGCCAGATCGGAAATCGACATCGAGCCGGACGCGATTCGAAAAGAGGTGCGAAAGCTCCCGGGCTAGCTCGTCGAACGCCAACGCCATCGTCGAATCCACGTACAGCATGCCGGAG-3’ ...
-
bioRxiv - Genetics 2021Quote: ... and 3 μg of each paired TALEN targeting either AAVS1 or CLYBL (Addgene, 59025/59026 or 62196/62197 ...
-
bioRxiv - Cancer Biology 2022Quote: ... PC-3 cells were transduced with lentivirus containing lentiCas9-Blast construct (Addgene #52962) and selected with growth medium containing 4 µg/ml blasticidin for approximately one week ...
-
bioRxiv - Developmental Biology 2023Quote: ... Bot oligo – 5’-aaacTTGGCACTCCATTAGATCCG-3’) were cloned into U6.3>gRNA.f+e (#99139, Addgene) and electroporated at a concentration of 1.5 ug/ul ...
-
bioRxiv - Genetics 2023Quote: ... and a poly-A p-3’entry clone (Addgene, Kristen Kwan, Chien lab) were used.
-
A modular circuit architecture coordinates the diversification of courtship strategies in DrosophilabioRxiv - Neuroscience 2023Quote: ... and the p10-3’UTR PCR amplified from the plasmid pJFRC81 (Addgene #36432). These were then cloned by Gibson assembly (NEB ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV-mDlx-ChR2-mCherry-Fishell-3 was a gift from Gordon Fishell (Addgene plasmid # 83898 ...
-
bioRxiv - Microbiology 2023Quote: S10-3 cells were transfected with the pSpCas9(BB)-2A-GFP (Addgene #48138) plasmid encoding the Cas 9 protein fused to GFP by the 2A peptide ...
-
bioRxiv - Cancer Biology 2023Quote: ... 14-3-3ζ was subcloned into pmTurquoise2-N1 (Addgene, Massachusetts, USA; plasmid # 54843) using restriction enzymes EcoRI (NEB ...
-
bioRxiv - Neuroscience 2024Quote: ... we bilaterally injected with RetroAAV-hSyn-Cre (500nL, Addgene Lot v70508, 3*1013) into the LS ...
-
bioRxiv - Neuroscience 2024Quote: ... 750 nl of the retroAAV-hsyn-Cre (500nL, Addgene Lot v70508, 3*1013) was injected in the VTA of male and female C57/BL6 mice ...
-
bioRxiv - Neuroscience 2021Quote: ... 6-7E6 cells were resuspended in nucleofection solution and mixed with 3ug of pCAG-EGFP plasmid (Addgene, 89684) and 600nM of siRNA ...
-
bioRxiv - Microbiology 2019Quote: ... C57BL/6 MEFs were transfected with GFP- or HA-epitope tagged ubiquitin plasmids (Addgene #11928 and #18712, respectively) 24 hours before infection ...
-
bioRxiv - Biochemistry 2020Quote: The original coding sequence for H2B:GFP was taken from pCS2-H2B:GFP plasmid (Addgene, Plasmid #53744, Supplementary Fig. 6), manually codon-optimized to minimize the occurrence of poly-Cn stretches (n<3) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The two sgRNAs targeting Dazl exon 6 were cloned into the pSpCas9(BB)-2A-GFP backbone (Addgene #48138). The knock-in led to the generation of a reporter cell line named Dazl-mScarlet-HygromycinR (DASH) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Two million iPSCs were electroporated with 6 μg of CAG- Cas9-T2A-EGFP-ires-Puro (deposited in Addgene, plasmid no ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV5-CMV-EGFP (Suppl. Figs. 1A, 6 and 7D; Salk Vector Core; 2.08 x 1012; Addgene plasmid #32395); AAV9-FLEX-rev-ChR2-tdTomato (Suppl ...
-
bioRxiv - Neuroscience 2020Quote: The DNA fragment of H2B-mEos4b-6 (a gift from Michael Davidson (Addgene plasmid # 57508; http://n2t.net/addgene:57508; RRID:Addgene_57508)) and TRE (pTRE-tight vector (Clontech #631059) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Lee and Luo 1999)- with the codon optimized GAL80 sequence from pBPGAL80Uw-6 - a gift from Gerald Rubin (Addgene plasmid #26236, http://n2t.net/addgene:26236; RRID:Addgene_26236) (Pfeiffer et al ...
-
bioRxiv - Developmental Biology 2023Quote: ... EGFP-Tubulin-6 was a gift from Michael Davidson (Addgene plasmid # 56450; http://n2t.net/addgene:56450; RRID: Addgene_56450). mTagBFP-Lysosomes-20 was a gift from Michael Davidson (Addgene plasmid # 55263 ...
-
bioRxiv - Neuroscience 2023Quote: ... 6 × 107 RPE1 cells were infected with the human sgRNA library (Human GeCKO v2 Library Cat#1000000048, Addgene) at an MOI of ∼0.3 ...
-
bioRxiv - Cell Biology 2023Quote: ... Two million iPSCs were electroporated with 6 µg of CAG-Cas9-T2A-EGFP-ires-Puro (deposited in Addgene, plasmid no ...
-
bioRxiv - Molecular Biology 2019Quote: ... GFP-POLE3 full length and GFP-POLE3 with amino acid residues 113-140 deleted (GFP-POLE3ΔC) were cloned between NheI and AgeI restriction sites of pCW57.1 (Addgene: 41393),
-
bioRxiv - Biochemistry 2021Quote: ... DNA encoding amino acids Ala696-Phe740 of human DDX1 was cloned into UC Berkeley MacroLab 438C (Addgene plasmid #55220). The resulting plasmid encoded for untagged RTCB(1-505) ...
-
bioRxiv - Cell Biology 2020Quote: mCherry-ER fusion protein was amplified by PCR from mCherry-ER-3 plasmid (Addgene) and cloned into Gateway modified pBABE (in house) ...
-
bioRxiv - Cell Biology 2020Quote: ... and 3’ extensions were annealed and cloned into pU6-pegRNA-GG-acceptor (Addgene #132777).
-
bioRxiv - Molecular Biology 2021Quote: ... a DNA fragment containing 5′-AGCCATGGGAAACATCGCAC-3′ was cloned into pL-CRISPR.EFS.tRFP (Addgene#57819) (Heckl et al. ...
-
bioRxiv - Molecular Biology 2020Quote: ... and pCMV4-3 HA/IkB-alpha was a gift from Warner Greene (Addgene, #21985). To generate firefly luciferase (Fluc)-expressing vector (pNL1.1.PGK[Fluc/PGK] ...
-
bioRxiv - Genomics 2020Quote: ... pCFJ104 - Pmyo-3∷mCherry∷unc-54 (Addgene plasmid # 19328; http://n2t.net/addgene:19328; RRID:Addgene_19328), and pMA122 - peel-1 negative selection (Addgene plasmid # 34873 ...
-
bioRxiv - Genomics 2020Quote: ... We then selected then 3 sgRNAs to be cloned into lentiGuide-Puro (52963, Addgene) as previously described95 ...
-
bioRxiv - Genetics 2020Quote: ... Gal4 5’ and 3’ homology arms were PCR-amplified using pDEST-APIGH (Addgene # 112804) as the template ...