Labshake search
Citations for Addgene :
1401 - 1450 of 1553 citations for 5 Bromo 2 Tert Butyldimethylsilyl 4 Methylthiazole since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: The 5’ UTR of CCND2 mRNA was cloned into the pGL3-TK-5UTR-BsmBI-Luciferase reporter plasmid purchased from Addgene (https://www.addgene.org/114670/). The DNA fragment was amplified from cDNA prepared from HEK293T using primers with the extra 5’ end corresponding to the BsmbI cut sites in the plasmid ...
-
bioRxiv - Cell Biology 2024Quote: ... together with 10 µg psPAX2 lentivirus packaging plasmid and 5 µg lentivirus envelope plasmid (gifts from Didier Trono, Addgene #12260 and #12259, respectively) using 90 µL 1 mg/mL Polyethylenimine Hydrochloride (Polysciences ...
-
bioRxiv - Neuroscience 2024Quote: ... D) or AAV2/5-CAG-dLight1.1 (left hemisphere: one mouse, right hemisphere: four mice, 111067-AAV5, Addgene, Watertown, MA, USA, Fig. 1E, F) was injected into the dorsomedial striatum (DMS ...
-
bioRxiv - Cell Biology 2024Quote: Suitable gRNA target sites (5 ′ gRNA: GGAGGCTCTCGTGCCGGCTC, 3 ′ gRNA: GCTATAGGAAGCCACCGTTA) were identified by CRISPR optimal target finder 45 and cloned into pCFD5 (Addgene plasmid #73914; 46) via Gibson assembly (NEB).
-
bioRxiv - Cell Biology 2020Quote: ... 3 x 105 HeLa cells were seeded into a 6-well plate and next day transfected with 2 μg of the FLPe recombinase plasmid (Addgene #20733) (Beard et al. ...
-
bioRxiv - Developmental Biology 2021Quote: ... two guideRNAs were designed to flank the target exon coding the β1-2 loop (see Table EV1 for primer sequences) and cloned into the guide RNA expression pCFD4 vector (Addgene #49411). The exon of interest and homology arms were cloned into donor template plasmid pHD-ScarlessDsRed (Addgene # 64703 ...
-
bioRxiv - Neuroscience 2021Quote: ... were added to each well along with 1 μl of Syn1-EBFP-Cre (serotype, 2-1; titer, 6×1012 genomes/mL; MOI, ∼8-0.08; Addgene, 51507-AAV1) delivered at full strength or diluted 1:103-104 ...
-
bioRxiv - Biophysics 2022Quote: ... NCBI Accession YP_009820873.1) were cloned with an N-terminal TEV protease-cleavable His6-tag using UC Berkeley Macrolab vector 2-BT (Addgene #29666). Truncations and other modified constructs were cloned by PCR mutagenesis and isothermal assembly ...
-
bioRxiv - Molecular Biology 2021Quote: ... four different gRNA sequences (see Table 2 for sequences; Fig. S3A) were multiplexed into a Cas9-nickase backbone (Addgene plasmid 48140) as previously described [64] ...
-
bioRxiv - Molecular Biology 2021Quote: ... The mammalian expression plasmid for RBD of SARS-CoV-2 protein S (spike) with 8xHis tag was obtained from Addgene (#145145). The mammalian expression vector for soluble ACE2 pcDNA3-sACE2 (WT)-sfGFP (#145171 ...
-
bioRxiv - Cancer Biology 2020Quote: V7 and V8 barcoding lentiviral transfer plasmids used for guide RNA array screening were constructed in 2-part Gibson assemblies using pLJM1-EGFP (Addgene #19319)53 backbone digested with EcoRI + gene blocks for V7 or V8 barcodes to make pLJM1-EGFP-V7 and pLJM1-EGFP-V8.
-
bioRxiv - Cancer Biology 2021Quote: Lentiviruses made from pLentiCRISPRv.2 were produced by co-transfection of the lentiviral backbone constructs and packaging plasmids pSPAX2 (Addgene 12260) and pMD2.G (Addgene 12259) ...
-
bioRxiv - Biochemistry 2021Quote: Spike display plasmids incorporate the pre-fusion stabilized SARS-CoV-2 S-6P (“HexaPro”) as the reference sequence for all spike variants (Addgene #154754)38 ...
-
bioRxiv - Bioengineering 2021Quote: ... by introducing 75 nt of the SARS-CoV-2 Leader sequence into the NheI-digested EFS-EGFPd2PEST-2A-Hygro plasmid (Addgene 138152). We inserted the TRS-Leader immediately before the coding sequence by ligation of annealed oligos (see Supplementary Table 3 for sequences) ...
-
bioRxiv - Cancer Biology 2020Quote: ... a sox10 minimal promoter was PCR amplified from genomic DNA from AB* larvae with primers (Table 1 and 2) containing overlapping nucleotides to sequences on either side of the AgeI site in pENTR-EGFP2 (Addgene #22450), similarly described in (Quillien et al. ...
-
bioRxiv - Neuroscience 2020Quote: Transfection for the CD63 overexpression construct was done as described above for siRNA transfection using 2 µg/mL of CD63-pEGFP (Addgene, USA) added for 5 h in Opti-MEM I Reduced Serum Medium (Thermo Fisher Scientific) ...
-
bioRxiv - Genomics 2021Quote: ... Prime editor 2 was expressed from pCMV-PE2 and pegRNAs from pU6-pegRNA-GG-acceptor plasmids30 (Addgene #132775 and #132777, respectively). Plasmid transfection was performed using FuGENE HD (Promega ...
-
bioRxiv - Neuroscience 2021Quote: Voltron2 and Channelrhodopsin2 were expressed throughout the motor cortex using injections of a mixture of (1) rAAVretro-hSyn-Cre-WPRE (2×109 g.c.; Addgene #105553-AAVrg), (2 ...
-
bioRxiv - Cancer Biology 2021Quote: Lentiviruses made from pLentiCRISPRv.2 were produced by co-transfection of the lentiviral backbone constructs and packaging plasmids pSPAX2 (Addgene 12260) and pMD2.G (Addgene 12259) ...
-
bioRxiv - Molecular Biology 2022Quote: PegRNAs-expressing plasmids (pU6-pegRNA) were cloned by ligating annealed oligo pairs (Supplemental table 2) with BsaI-digested pU6-peg-GG-acceptor (Addgene #132777) as described previously (Anzalone et al. ...
-
bioRxiv - Cancer Biology 2022Quote: MIA PaCa-2 wild type (WT) and TSC1/TSC2 knockout (KO) cells were transduced with retrovirus expressing RFP (pQCXIP-turboRFP, Addgene #73016) or EGFP (pQCXIP-EGFP-F ...
-
bioRxiv - Biophysics 2022Quote: ... a pQE-30/pcl-ts ind+ plasmid containing a His6-SUMO SARS-CoV-2 nsp12 and untagged nsp7 & 8 (Addgene #160540) was transformed into E ...
-
bioRxiv - Immunology 2020Quote: ... and upstream of VH81-X (downstream of VH2-2) (Cut2) were cloned by annealing pairs of oligos into pX459 with a puromycin selection marker (Addgene, #62988) following the standard protocol ...
-
bioRxiv - Microbiology 2021Quote: The lentiviral sgRNAeBAR-expressing backbone was constructed by inserting sgRNA scaffold embedded MS2 loops at tetraloop and stemloop 2 along with eBAR sequence into pLenti-sgRNA-Lib (Addgene, 53121). The sgRNA-expressing sequences were cloned into the backbone using the BsmBI-mediated Golden Gate cloning strategy (47) ...
-
bioRxiv - Neuroscience 2021Quote: ... HEK293T cells were transfected using Fugene HD transfection reagent in a 3:1 reagent : DNA ratio with packaging plasmid 2 µg psPAX2 (a gift from Didier Trono, Addgene, #12260), 1 µg murine ecotropic envelope plasmid pEnv(eco)-IRES-puro (Morita et al ...
-
bioRxiv - Genomics 2020Quote: ... 10 human non-targeting sgRNAs and 10 mouse non-targeting sgRNAs (Supplementary Table 2) were individually synthesized and cloned into the lentiviral transfer vector CROPseq-Guide-Puro3 (Addgene 86708), which leads to the synthesis of an RNA Pol3 transcript of the Cas9 sgRNA and an RNA Pol2 polyadenylated transcript containing the puromycin resistance gene ...
-
bioRxiv - Genetics 2020Quote: ... a single guide sequence (primers JBW0001/2) targeting MSH2 exon 6 was cloned into pSpCas9(BB)-2A-GFP (PX458, Addgene #48138) as described24 ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 S / HIV-1 pseudotyped viruses were packaged by co-transfecting a lentiviral construct pHIV-Luciferase (Addgene plasmid # 21375), a packaging construct psPAX2 (Addgene plasmid # 12260 ...
-
bioRxiv - Neuroscience 2021Quote: To generate CRISPR-Cas9 targeting constructs we used the pSpCas9n(BB)-2A-Puro V2.0 (Px462v.2, a gift from Feng Zhang, Addgene plasmid #62987). Px462v.2 plasmid [3] was simultaneously digested and ligated to annealed oligo duplexes diluted 1:200 ...
-
bioRxiv - Neuroscience 2022Quote: ... Experiments with inducible Cre used 2-20 fmol (10-100 ng) pCAG ERT2-Cre-ERT2 (Addgene #3777, Matsuda and Cepko, 2007) per coverslip ...
-
bioRxiv - Cell Biology 2020Quote: hCIB2 was subcloned into pET21a (histidine tag on the C-terminus; hCIB2-6xHis) and GST-Rheb in pGEX-4T-2 (Addgene #15889), transformed in Bl2 (DE3 ...
-
bioRxiv - Molecular Biology 2021Quote: The SARS-CoV-2 Nsp3 macrodomain (Uniprot identifier P0DTC1, residues 1024-1192) was cloned into pNH-TrxT vector (Addgene plasmid #26106) using SLIC restriction free cloning method (Jeong et al ...
-
bioRxiv - Immunology 2021Quote: The transfection mix was made by dissolving 2 μg of the indicated vectors in combination with 0.4 μg of the helper plasmid pCL-ECO (Addgene plasmid 12371) (Naviaux et al. ...
-
bioRxiv - Immunology 2023Quote: Pseudovirus expressing Wuhan-Hu-1 SARS-CoV-2 S protein were produced by co-transfection of plasmids encoding a GFP protein (Addgene, 11619), a lentivirus backbone (VRC5602 ...
-
bioRxiv - Microbiology 2022Quote: Individual sgRNAs (2 per gene) from the Brie library or designed using Benchling (S3 Table) were cloned into lentiGuide-Puro (Addgene #52963), lentiCRISPR v2-blast (Addgene #98293) ...
-
bioRxiv - Immunology 2022Quote: SARS-CoV-2 spike-pseudotyped lentiviruses encoding a luciferase-ZsGreen reporter were produced using the same method but with plasmids encoding SARS-CoV-2 spike (HDM-SARS2-spike-delta21, Addgene #155130) or its variants of concern ...
-
bioRxiv - Neuroscience 2023Quote: ... transfection mix for each plasmid was prepared in the following manner: 1 µg of transfer plasmid and 2 µg of second-generation packaging DNA mix containing psPAX (Addgene #12260) and pMD2.G (Addgene #12259 ...
-
bioRxiv - Biochemistry 2023Quote: The pET28-eGFP-SLAP was digested with BamHI and XhoI restriction enzymes and the SLAPTAG-containing band was subcloned into SARS-CoV-2 S HexaPro plasmid (Addgene#154754) with the same restriction sites.
-
bioRxiv - Genomics 2023Quote: ... the entry vector was constructed by adding a bcl-2 splice acceptor and four SV40 polyA-signals to a plasmid backbone based on pSMART (Addgene #49157) containing a green fluorescent protein (GFP ...
-
bioRxiv - Cancer Biology 2023Quote: HEK293 cells were transfected with a mixture of the 3rd generation lentiviral packaging plasmids containing: 2 μg of Rev (pRSV-Rev, Addgene #12253), 2 μg of Gag and Pol (pMDLg/pRRE ...
-
bioRxiv - Neuroscience 2023Quote: We used AAV1-hSyn-GCaMP6f (2 × 1013 vg/mL Penn Vector Core/Addgene; diluted 1:8 to 1:15 in saline) for experiments involving two-photon calcium imaging of V1 layer 2/3 cells ...
-
bioRxiv - Developmental Biology 2023Quote: Two gRNAs were designed to target the exon 3 of REV1 (Supplementary Table 2) and subcloned into the PX458 plasmid (Addgene, 48138). 5.0-8.0 × 105 BTAG cells were electroporated with 3 μg of each gRNA using Amaxa 4D nucleofector (Lonza ...
-
bioRxiv - Plant Biology 2023Quote: ... vectors encoding a nitrate-responsive green luciferase (AtNRPP-Eluc-Hsp18-2) and constitutively-expressed red luciferase (pNOS-Rluc-tNOS; pGREAT27, Addgene #170915) are delivered to root protoplasts ...
-
bioRxiv - Neuroscience 2023Quote: ... oligos encoding guide RNAs targeting intron 2 and intron 3 of murine Dyrk1a were cloned into plasmid pX459 v2.0 (Addgene plasmid # 62988) and sequence verified ...
-
bioRxiv - Cell Biology 2024Quote: ... The HTR8 cells with mir-218 KO were generated by cloning gRNAs that target mir-218-1 and mir-218-2 into a CRISPR/Cas9 vector PX459 (Addgene #62988). The plasmid was verified by sequencing ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2018] genomic DNA using RLO336/RLO338 and RLO337/RLO339 primers (Table 2) which introduce sequences homologous to the regions flanking the SacI and HindIII sites of pRG216 (Addgene #64528) [Gnügge and Rudolf 2017] ...
-
bioRxiv - Genomics 2024Quote: ... DNMT1 and respective mutants (Table 2) were cloned into the pMXs-IRES-blasticidin retroviral vector (a gift from David Sabatini, Addgene #72876) by EcoRI and XhoI restriction sites without an affinity tag ...
-
bioRxiv - Cancer Biology 2023Quote: ... self-complementary single-stranded DNA oligos (Supplementary Table 2) were annealed and cloned into AgeI/EcoRI sites of Tet-pLKO-puro vector (Addgene, #21915). Tet-pLKO-puro vectors were packaged into a lentivirus system with pCMV-VSV-G (Addgene ...
-
bioRxiv - Neuroscience 2024Quote: ... that was first PCR amplified using custom primers (see Table 2) from a plasmid containing lexAop2 (lexAop2-myr-4xSNAPf, RRID: Addgene 87638) and then restriction digested using HindIII and PspXI (New England BioLabs ...
-
bioRxiv - Neuroscience 2024Quote: ... Pups were injected unilaterally with 1 μl of AAV9-hSyn-DIO-ChrimsonR-mRuby2-ST (2 × 1012 gc ml−1; Addgene #105448) or 1 μl of AAV9-CAG-Flex-ArchT (2 × 1012 gc ml−1 ...